Transcript: Human XM_011528802.2

PREDICTED: Homo sapiens potassium voltage-gated channel modifier subfamily G member 1 (KCNG1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KCNG1 (3755)
Length:
2376
CDS:
452..1993

Additional Resources:

NCBI RefSeq record:
XM_011528802.2
NBCI Gene record:
KCNG1 (3755)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528802.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430949 GTGACATCTTGTTCGGAAGTG pLKO_005 1944 CDS 100% 4.050 5.670 N KCNG1 n/a
2 TRCN0000438927 ACAATAACTGAGCGCGGAGGA pLKO_005 1983 CDS 100% 2.160 3.024 N KCNG1 n/a
3 TRCN0000045111 CTCGGACACCAGAGACAATAA pLKO.1 1969 CDS 100% 13.200 9.240 N KCNG1 n/a
4 TRCN0000045112 CACCTGCAACGAGTTCTTCTT pLKO.1 781 CDS 100% 4.950 3.465 N KCNG1 n/a
5 TRCN0000445273 GAGCAAGAGAGGGTGATGTTC pLKO_005 1868 CDS 100% 4.950 3.465 N KCNG1 n/a
6 TRCN0000045110 GATGTGCCACAACGTCTTCAT pLKO.1 1240 CDS 100% 4.950 3.465 N KCNG1 n/a
7 TRCN0000441310 ATTGAGGAGTTCGCGGAGATG pLKO_005 968 CDS 100% 4.050 2.835 N KCNG1 n/a
8 TRCN0000442170 CGTGAAAGGAAGCTGGGTCAT pLKO_005 2202 3UTR 100% 4.050 2.835 N KCNG1 n/a
9 TRCN0000442744 CTGTTCCCAGATGTGCCACAA pLKO_005 1231 CDS 100% 4.050 2.835 N KCNG1 n/a
10 TRCN0000421523 TACGTCATCGAGAACGAGATG pLKO_005 1637 CDS 100% 4.050 2.835 N KCNG1 n/a
11 TRCN0000045108 CGTCGGATCATCATCAACGTA pLKO.1 638 CDS 100% 3.000 2.100 N KCNG1 n/a
12 TRCN0000428497 GAACACTAGAACATCAGCAGA pLKO_005 2156 3UTR 100% 2.640 1.848 N KCNG1 n/a
13 TRCN0000045109 CCAGGACAGTGACATCTTGTT pLKO.1 1936 CDS 100% 4.950 2.970 N KCNG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528802.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10933 pDONR223 100% 51.6% 49.8% None (many diffs) n/a
2 ccsbBroad304_10933 pLX_304 0% 51.6% 49.8% V5 (many diffs) n/a
3 TRCN0000480643 CTGGCTGCAGCAATGCAAGATCGT pLX_317 52.6% 51.6% 49.8% V5 (many diffs) n/a
4 TRCN0000492242 CCTAGAACAACGAAGAACAGCATC pLX_317 46.6% 51.6% 49.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV