Construct: ORF TRCN0000480672
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006732.1_s317c1
- Derived from:
- ccsbBroadEn_04454
- DNA Barcode:
- ACGTCTTTACACTTGCCTAGATCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FBXL20 (84961)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480672
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 84961 | FBXL20 | F-box and leucine rich repe... | NM_032875.3 | 100% | 100% | |
| 2 | human | 84961 | FBXL20 | F-box and leucine rich repe... | NM_001184906.2 | 92.6% | 92.6% | 398_399ins96 |
| 3 | human | 84961 | FBXL20 | F-box and leucine rich repe... | NM_001370208.1 | 90.4% | 89.6% | (many diffs) |
| 4 | human | 84961 | FBXL20 | F-box and leucine rich repe... | NM_001370209.1 | 83.6% | 82.8% | (many diffs) |
| 5 | mouse | 72194 | Fbxl20 | F-box and leucine-rich repe... | NM_028149.1 | 93.1% | 99.7% | (many diffs) |
| 6 | mouse | 72194 | Fbxl20 | F-box and leucine-rich repe... | XM_006534298.4 | 90.5% | 95.2% | (many diffs) |
| 7 | mouse | 72194 | Fbxl20 | F-box and leucine-rich repe... | XM_006534299.4 | 89.9% | 96.5% | (many diffs) |
| 8 | mouse | 72194 | Fbxl20 | F-box and leucine-rich repe... | XM_030246362.1 | 59.4% | 63.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1374
- ORF length:
- 1308
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag gagggacgtg aacggagtga ccaagagcag gtttgagatg ttctcaaata 121 gtgatgaagc tgtaatcaat aaaaaacttc ccaaagaact cctgttacgg atattttctt 181 ttctagatgt tgttaccctg tgccgctgtg ctcaggtctc cagggcctgg aatgttctgg 241 ctctggatgg cagtaactgg cagcgaattg acctatttga tttccagagg gatattgagg 301 gccgagtagt ggagaatatt tcaaaacgat gtgggggctt tttacgaaag ttaagtcttc 361 gtggatgtct tggagtggga gacaatgcat taagaacctt tgcacaaaac tgcaggaaca 421 ttgaagtact gaatctaaat gggtgtacaa agacaacaga cgctacatgt actagcctta 481 gcaagttctg ttccaaactc aggcaccttg acttggcttc ctgtacatca ataacaaaca 541 tgtctctaaa agctctgagt gagggatgtc cactgttgga gcagttgaac atttcctggt 601 gtgaccaagt aaccaaggat ggcattcaag cactagtgag gggctgtggg ggtctcaagg 661 ccttattctt aaaaggctgc acgcagctag aagatgaagc tctcaagtac ataggtgcac 721 actgccctga actggtgact ttgaacttgc agacttgctt gcaaatcaca gatgaaggtc 781 tcattactat atgcagaggg tgccataagt tacaatccct ttgtgcctct ggctgctcca 841 acatcacaga tgccatcctg aatgctctag gtcagaactg cccacggctt agaatattgg 901 aagtggcaag atgttctcaa ttaacagatg tgggctttac cactctagcc aggaattgcc 961 atgaacttga aaagatggac ctggaagagt gtgttcagat aacagatagc acattaatCC 1021 AACTTTCTAT ACACTGTCCT CGACTTCAAG TATTGAGTCT GTCTCACTGT GAGCTGATCA 1081 CAGATGATGG AATTCGTCAC CTGGGGAATG GGGCCTGCGC CCATGACCAG CTGGAGGTGA 1141 TTGAGCTGGA CAACTGCCCA CTAATCACAG ATGCATCCCT GGAGCACTTG AAGAGCTGTC 1201 ATAGCCTTGA GCGGATAGAA CTCTATGACT GCCAGCAAAT CACACGGGCT GGAATCAAGA 1261 GACTCAGGAC CCATTTACCC AATATTAAAG TCCACGCCTA CTTCGCACCT GTCACTCCAC 1321 CCCCATCAGT AGGGGGCAGC AGACAGCGCT TCTGCAGATG CTGCATCATC CTATGCCCAA 1381 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1441 ATTCTACGTA GTAATGAACT AGCCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1501 TATCTTGTGG AAAGGACGAA CGTCTTTACA CTTGCCTAGA TCAACGCGTT AAGTCgacaa 1561 tcaacctctg gattacaaaa tttgtgaaag att