Transcript: Human NM_001370209.1

Homo sapiens F-box and leucine rich repeat protein 20 (FBXL20), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
FBXL20 (84961)
Length:
10354
CDS:
232..1557

Additional Resources:

NCBI RefSeq record:
NM_001370209.1
NBCI Gene record:
FBXL20 (84961)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370209.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073322 GCCGAGTAGTGGAGAATATTT pLKO.1 578 CDS 100% 15.000 21.000 N FBXL20 n/a
2 TRCN0000327648 GCCGAGTAGTGGAGAATATTT pLKO_005 578 CDS 100% 15.000 21.000 N FBXL20 n/a
3 TRCN0000073321 GCCCACTAATCACAGATGCAT pLKO.1 1337 CDS 100% 3.000 2.400 N FBXL20 n/a
4 TRCN0000312583 AGGACCCATTTACCCAATATT pLKO_005 1447 CDS 100% 15.000 10.500 N FBXL20 n/a
5 TRCN0000312523 GAACTCCTGTTACGGATATTT pLKO_005 433 CDS 100% 15.000 10.500 N FBXL20 n/a
6 TRCN0000312584 GATGAAGGTCTCATTACTATA pLKO_005 952 CDS 100% 13.200 9.240 N FBXL20 n/a
7 TRCN0000073319 GCCAGGAATTGCCATGAACTT pLKO.1 1129 CDS 100% 4.950 3.465 N FBXL20 n/a
8 TRCN0000073318 CCTAAATGGTTGCCTTGAAAT pLKO.1 2153 3UTR 100% 13.200 7.920 N FBXL20 n/a
9 TRCN0000327649 CCTAAATGGTTGCCTTGAAAT pLKO_005 2153 3UTR 100% 13.200 7.920 N FBXL20 n/a
10 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 8690 3UTR 100% 4.950 2.475 Y ERAP2 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 8691 3UTR 100% 13.200 6.600 Y LIAS n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 6936 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 3795 3UTR 100% 2.640 1.320 Y LINC01098 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 6936 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370209.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04454 pDONR223 100% 83.6% 82.8% None (many diffs) n/a
2 ccsbBroad304_04454 pLX_304 0% 83.6% 82.8% V5 (many diffs) n/a
3 TRCN0000480672 ACGTCTTTACACTTGCCTAGATCA pLX_317 27.5% 83.6% 82.8% V5 (many diffs) n/a
Download CSV