Construct: ORF TRCN0000480682
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002551.3_s317c1
- Derived from:
- ccsbBroadEn_14533
- DNA Barcode:
- TACGAAAATTGAGCCGTCGATGAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GRK3 (157)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480682
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 157 | GRK3 | G protein-coupled receptor ... | NM_005160.4 | 56.2% | 56.2% | 1161_2064delinsA |
| 2 | human | 157 | GRK3 | G protein-coupled receptor ... | NM_001362778.2 | 39.7% | 39.8% | 0_1ins339;822_1725delinsA |
| 3 | human | 157 | GRK3 | G protein-coupled receptor ... | XM_011529975.2 | 32.2% | 32.2% | 0_1ins495;666_1569delinsA |
| 4 | human | 157 | GRK3 | G protein-coupled receptor ... | XR_937823.1 | 12.7% | 1_13del;1175_9074del | |
| 5 | human | 157 | GRK3 | G protein-coupled receptor ... | XR_001755175.1 | 12.7% | 1_13del;1174_9100delinsA | |
| 6 | mouse | 320129 | Grk3 | G protein-coupled receptor ... | NM_177078.4 | 47.3% | 52.9% | (many diffs) |
| 7 | mouse | 320129 | Grk3 | G protein-coupled receptor ... | NM_001285806.1 | 33.9% | 38.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1227
- ORF length:
- 1161
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggacctggag gctgtgctgg ccgatgtcag ttacctgatg gccatggaga 121 agagcaaggc gaccccggcc gcccgcgcca gcaagaggat cgtcctgccg gagcccagta 181 tccggagtgt gatgcagaag taccttgcag agagaaatga aataaccttt gacaagattt 241 tcaatcagaa aattggtttc ttgctattta aagatttttg tttgaatgaa attaatgaag 301 ctgtacctca ggtgaagttt tatgaagaga taaaggaata tgaaaaactt gataatgagg 361 aagaccgcct ttgcagaagt cgacaaattt atgatgccta catcatgaag gaacttcttt 421 cctgttcaca tcctttctca aagcaagctg tagaacacgt acaaagtcat ttatccaaga 481 aacaagtgac atcaactctt tttcagccat acatagaaga aatttgtgaa agccttcgag 541 gtgacatttt tcaaaaattt atggaaagtg acaagttcac tagattttgt cagtggaaaa 601 acgttgaatt aaatatccat ttgaccatga atgagttcag tgtgcatagg attattggac 661 gaggaggatt cggggaagtt tatggttgca ggaaagcaga cactggaaaa atgtatgcaa 721 tgaaatgctt agataagaag aggatcaaaa tgaaacaagg agaaacatta gccttaaatg 781 aaagaatcat gttgtctctt gtcagcacag gagactgtcc tttcattgta tgtatgacct 841 atgccTTCCA TACCCCAGAT AAACTCTGCT TCATCCTGGA TCTGATGAAC GGGGGCGATT 901 TGCACTACCA CCTTTCACAA CACGGTGTGT TCTCTGAGAA GGAGATGCGG TTTTATGCCA 961 CTGAAATCAT TCTGGGTCTG GAACACATGC ACAATCGGTT TGTTGTCTAC AGAGATTTGA 1021 AGCCAGCAAA TATTCTCTTG GATGAACATG GACACGCAAG AATATCAGAT CTTGGTCTTG 1081 CCTGCGATTT TTCCAAAAAG AAGCCTCATG CGAGTGTTGG CACCCATGGG TACATGGCTC 1141 CCGAGGTGCT GCAGAAGGGG ACGGCCTATG ACAGCAGTGC CGACTGGTTC TCCCTGGGCT 1201 GCATGCTTTT CAAACTTCTG AGAGGATGCC CAACTTTCTT GTACAAAGTG GTTGATATCG 1261 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1321 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GATACGAAAA 1381 TTGAGCCGTC GATGATACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1441 aagatt