Transcript: Human XR_937823.1

PREDICTED: Homo sapiens G protein-coupled receptor kinase 3 (GRK3), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRK3 (157)
Length:
9074
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_937823.1
NBCI Gene record:
GRK3 (157)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_937823.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002035 GAGTTCAGTGTGCATAGGATT pLKO.1 581 3UTR 100% 4.950 6.930 N GRK3 n/a
2 TRCN0000197177 GCTACTTGATTGCGACCAAGA pLKO.1 1654 3UTR 100% 4.050 5.670 N GRK3 n/a
3 TRCN0000196297 GCCTTTGATATTGGCTCATTT pLKO.1 1607 3UTR 100% 13.200 10.560 N GRK3 n/a
4 TRCN0000197120 GCAGTTGTGTGACAGTCATTC pLKO.1 3081 3UTR 100% 10.800 8.640 N GRK3 n/a
5 TRCN0000010678 GCACTTCGCAACTGACTTCTT pLKO.1 2683 3UTR 100% 4.950 3.960 N GRK3 n/a
6 TRCN0000320831 CTCCTACTTATCACGTAAATT pLKO_005 2486 3UTR 100% 15.000 10.500 N GRK3 n/a
7 TRCN0000381380 AGCCCTTTCAGACAACATAAA pLKO_005 1328 3UTR 100% 13.200 9.240 N GRK3 n/a
8 TRCN0000002037 CAGCCCTTTCAGACAACATAA pLKO.1 1327 3UTR 100% 13.200 9.240 N GRK3 n/a
9 TRCN0000195552 CCTAAGCATTGCCACATATTC pLKO.1 2584 3UTR 100% 13.200 9.240 N GRK3 n/a
10 TRCN0000320829 CCTTTGCAGAAGTCGACAAAT pLKO_005 316 3UTR 100% 13.200 9.240 N GRK3 n/a
11 TRCN0000350290 TCAGTGGCAGCGTCGCTATTT pLKO_005 1885 3UTR 100% 13.200 9.240 N GRK3 n/a
12 TRCN0000320947 AGCTGTAGAACACGTACAAAG pLKO_005 394 3UTR 100% 10.800 7.560 N GRK3 n/a
13 TRCN0000381594 GAATGACACTCACCGTGAATG pLKO_005 1374 3UTR 100% 10.800 7.560 N GRK3 n/a
14 TRCN0000379514 GATGAGGCATCTGATCTATTC pLKO_005 2297 3UTR 100% 10.800 7.560 N GRK3 n/a
15 TRCN0000196937 GCAGCAAGAAGTAACGGAAAC pLKO.1 1714 3UTR 100% 6.000 4.200 N GRK3 n/a
16 TRCN0000197191 GCATGAAATTGACCGAATGAC pLKO.1 1360 3UTR 100% 4.950 3.465 N GRK3 n/a
17 TRCN0000002036 TGGAAGAAAGAGTTGAACGAA pLKO.1 2090 3UTR 100% 3.000 2.100 N GRK3 n/a
18 TRCN0000320828 TGGAAGAAAGAGTTGAACGAA pLKO_005 2090 3UTR 100% 3.000 2.100 N GRK3 n/a
19 TRCN0000002034 CAGTAAATGCAGACACAGATA pLKO.1 1746 3UTR 100% 4.950 2.970 N GRK3 n/a
20 TRCN0000084008 CGCCTATAATCCCAGCACTTT pLKO.1 5464 3UTR 100% 4.950 2.475 Y NPHS1 n/a
21 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3897 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_937823.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489765 AGATTGATGGAGATGCTAGTGCAT pLX_317 12.3% 22.7% V5 (many diffs) n/a
2 TRCN0000489828 GAGTTGCAACCATACGTGGCCTTA pLX_317 22.2% 22.7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_10673 pDONR223 100% 12.7% None 1_13del;1175_9074del n/a
4 ccsbBroad304_10673 pLX_304 0% 12.7% V5 1_13del;1175_9074del n/a
5 TRCN0000472319 TGAAGCCTTCCCCTGCCAGCCGAG pLX_317 9.3% 12.7% V5 1_13del;1175_9074del n/a
6 ccsbBroadEn_14533 pDONR223 0% 12.7% None 1_13del;1175_9074del n/a
7 ccsbBroad304_14533 pLX_304 0% 12.7% V5 1_13del;1175_9074del n/a
8 TRCN0000480682 TACGAAAATTGAGCCGTCGATGAT pLX_317 33.1% 12.7% V5 1_13del;1175_9074del n/a
Download CSV