Construct: ORF TRCN0000480701
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009158.1_s317c1
- Derived from:
- ccsbBroadEn_14976
- DNA Barcode:
- TCCATTGAACCTATCGGGTCTCCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ARPP21 (10777)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480701
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | NM_016300.4 | 99.7% | 99.5% | (many diffs) |
| 2 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_005264811.3 | 95.6% | 95.3% | (many diffs) |
| 3 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005576.2 | 95.6% | 95.3% | (many diffs) |
| 4 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005577.2 | 95.6% | 95.3% | (many diffs) |
| 5 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005580.2 | 95.6% | 95.3% | (many diffs) |
| 6 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_011533298.3 | 95.5% | 95.2% | (many diffs) |
| 7 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_011533299.3 | 95.5% | 95.2% | (many diffs) |
| 8 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_011533300.3 | 95.5% | 95.2% | (many diffs) |
| 9 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_011533301.3 | 95.5% | 95.2% | (many diffs) |
| 10 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_011533302.3 | 95.5% | 95.2% | (many diffs) |
| 11 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_011533303.3 | 95.5% | 95.2% | (many diffs) |
| 12 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005574.2 | 95.5% | 95.2% | (many diffs) |
| 13 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005575.2 | 95.5% | 95.2% | (many diffs) |
| 14 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_024453320.1 | 95.5% | 95.2% | (many diffs) |
| 15 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005582.2 | 95.5% | 95.2% | (many diffs) |
| 16 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005583.2 | 95.5% | 95.2% | (many diffs) |
| 17 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005579.2 | 95.4% | 95.1% | (many diffs) |
| 18 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005581.2 | 95.4% | 95.1% | (many diffs) |
| 19 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005585.2 | 93.3% | 93.3% | (many diffs) |
| 20 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005586.2 | 93.3% | 93.3% | (many diffs) |
| 21 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005587.2 | 93.3% | 93.3% | (many diffs) |
| 22 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005588.2 | 93.3% | 93.3% | (many diffs) |
| 23 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005589.2 | 93.3% | 93.3% | (many diffs) |
| 24 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005590.2 | 93.3% | 93.3% | (many diffs) |
| 25 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_024453322.1 | 93.3% | 93.3% | (many diffs) |
| 26 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005584.2 | 93.2% | 93.2% | (many diffs) |
| 27 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | NM_001267619.1 | 91.6% | 91.3% | (many diffs) |
| 28 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_006712943.3 | 91.6% | 91.3% | (many diffs) |
| 29 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005592.2 | 91.6% | 91.3% | (many diffs) |
| 30 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005593.2 | 91.6% | 91.3% | (many diffs) |
| 31 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005594.1 | 91.6% | 91.3% | (many diffs) |
| 32 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005595.2 | 91.6% | 91.3% | (many diffs) |
| 33 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005591.2 | 91.5% | 91.2% | (many diffs) |
| 34 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005597.2 | 91.4% | 91.2% | (many diffs) |
| 35 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005598.2 | 91.4% | 91.2% | (many diffs) |
| 36 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005596.2 | 91.3% | 91.1% | (many diffs) |
| 37 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | NM_001267617.1 | 89.3% | 89.3% | (many diffs) |
| 38 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_006712944.3 | 89.3% | 89.3% | (many diffs) |
| 39 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005602.2 | 89.3% | 89.3% | (many diffs) |
| 40 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005603.2 | 89.3% | 89.3% | (many diffs) |
| 41 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005604.2 | 89.3% | 89.3% | (many diffs) |
| 42 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005605.2 | 89.3% | 89.3% | (many diffs) |
| 43 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005606.2 | 89.3% | 89.3% | (many diffs) |
| 44 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_024453323.1 | 89.3% | 89.3% | (many diffs) |
| 45 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005599.2 | 89.2% | 89.2% | (many diffs) |
| 46 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005600.2 | 89.2% | 89.2% | (many diffs) |
| 47 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005601.2 | 89.2% | 89.2% | (many diffs) |
| 48 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005607.2 | 76.2% | 76% | (many diffs) |
| 49 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_024453324.1 | 63.9% | 63.7% | (many diffs) |
| 50 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005610.2 | 51.3% | 51.3% | 0_1ins1131;513_617del |
| 51 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | XM_017005612.2 | 51.3% | 51.3% | 0_1ins1131;513_617del |
| 52 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | NM_001025068.1 | 10.7% | 10.5% | (many diffs) |
| 53 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | NM_001025069.1 | 10.7% | 10.5% | (many diffs) |
| 54 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | NM_001267616.2 | 10.7% | 10.5% | (many diffs) |
| 55 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | NM_001267618.2 | 10.7% | 10.5% | (many diffs) |
| 56 | human | 10777 | ARPP21 | cAMP regulated phosphoprote... | NM_198399.2 | 10.7% | 10.5% | (many diffs) |
| 57 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_006512347.3 | 85.9% | 86.4% | (many diffs) |
| 58 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | NM_033264.2 | 85.8% | 86.3% | (many diffs) |
| 59 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_006512348.3 | 85.8% | 86.3% | (many diffs) |
| 60 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_017313657.1 | 85.8% | 86.3% | (many diffs) |
| 61 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_017313662.1 | 83.8% | 84.6% | (many diffs) |
| 62 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_006512324.3 | 82.3% | 82.8% | (many diffs) |
| 63 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_006512326.3 | 82.3% | 82.8% | (many diffs) |
| 64 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_006512329.3 | 82.3% | 82.8% | (many diffs) |
| 65 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_006512330.3 | 82.3% | 82.8% | (many diffs) |
| 66 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_006512333.2 | 82.3% | 82.8% | (many diffs) |
| 67 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_006512334.3 | 82.3% | 82.8% | (many diffs) |
| 68 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_006512338.3 | 82.3% | 82.8% | (many diffs) |
| 69 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_011243036.2 | 82.3% | 82.7% | (many diffs) |
| 70 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_017313635.1 | 82.3% | 82.7% | (many diffs) |
| 71 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_017313636.1 | 82.3% | 82.7% | (many diffs) |
| 72 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_017313637.1 | 82.2% | 82.7% | (many diffs) |
| 73 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_017313638.1 | 82.2% | 82.7% | (many diffs) |
| 74 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_017313641.1 | 82.1% | 82.6% | (many diffs) |
| 75 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_006512351.3 | 81.8% | 82.2% | (many diffs) |
| 76 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_017313663.1 | 81.8% | 82.2% | (many diffs) |
| 77 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_017313643.1 | 80.4% | 81.2% | (many diffs) |
| 78 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_017313645.1 | 80.3% | 81.1% | (many diffs) |
| 79 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_017313646.1 | 80.3% | 81.1% | (many diffs) |
| 80 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_017313647.1 | 80.3% | 81.1% | (many diffs) |
| 81 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_017313664.1 | 79.8% | 80.5% | (many diffs) |
| 82 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_017313665.1 | 79.8% | 80.5% | (many diffs) |
| 83 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_017313655.1 | 79.8% | 80.6% | (many diffs) |
| 84 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | NM_001177618.1 | 78.4% | 78.8% | (many diffs) |
| 85 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_006512344.3 | 78.4% | 78.8% | (many diffs) |
| 86 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_017313650.1 | 78.4% | 78.8% | (many diffs) |
| 87 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_017313651.1 | 78.4% | 78.8% | (many diffs) |
| 88 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_017313652.1 | 78.4% | 78.8% | (many diffs) |
| 89 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_017313653.1 | 78.4% | 78.8% | (many diffs) |
| 90 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_011243040.2 | 78.3% | 78.7% | (many diffs) |
| 91 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_017313656.1 | 78.3% | 78.7% | (many diffs) |
| 92 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_017313631.1 | 76.6% | 77.3% | (many diffs) |
| 93 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_017313633.1 | 76.5% | 77.2% | (many diffs) |
| 94 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | NM_001177616.1 | 76.5% | 77.2% | (many diffs) |
| 95 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_006512350.3 | 76.5% | 77.2% | (many diffs) |
| 96 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_017313659.1 | 76.5% | 77.2% | (many diffs) |
| 97 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_017313660.1 | 76.5% | 77.2% | (many diffs) |
| 98 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_017313634.1 | 76.5% | 77.2% | (many diffs) |
| 99 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_017313640.1 | 76.4% | 77.1% | (many diffs) |
| 100 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_017313642.1 | 74.8% | 75.7% | (many diffs) |
| 101 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_017313644.1 | 74.7% | 75.6% | (many diffs) |
| 102 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_017313648.1 | 72.9% | 73.4% | (many diffs) |
| 103 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_017313654.1 | 72.7% | 73.3% | (many diffs) |
| 104 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | XM_017313658.1 | 71% | 71.8% | (many diffs) |
| 105 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | NM_001177619.1 | 38.4% | 35.7% | (many diffs) |
| 106 | mouse | 74100 | Arpp21 | cyclic AMP-regulated phosph... | NM_001177623.1 | 25.8% | 25.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2502
- ORF length:
- 2436
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc tgagcaagga gacctatatc aggcaatagc agaggaagga gggactgagc 121 aggagacggc cactccagag aacggcattg ttaaatcaga aagtctggat gaagaggaga 181 aactggaact gcagaggcgg ctggaggctc agaatcaaga aagaagaaaa tccaagtcag 241 gagcaggaaa aggtaaactg actcgcagtc ttgctgtctg tgaggaatct tctgccagac 301 caggaggtga aagtcttcag gatcaggaat caattcattt acagctttcc agtttttcca 361 gcctgcaaga ggaggataaa tctaggaaag atgactctga aagagaaaaa gaaaaggata 421 aaaacaaaga taaaacctct gaaaaaccca agatcagaat gttatcaaaa gattgcagcc 481 aagaatacac ggattctaca ggcatagact tacacgagtt tctgattaac acattaaaga 541 ataattccag ggacaggatg atacttttga aaatggagca ggaaattatt gatttcattg 601 ctgacaacaa taatcattat aaaaagttcc ctcagatgtc atcgtatcag aggatgcttg 661 tccatcgagt ggcagcttat tttggattgg atcacaatgt ggatcaaaca ggaaaatctg 721 ttatcatcaa caagaccagc agcaccagaa taccagagca aaggttttgt gaacatttaa 781 aagatgaaaa aggtgaagaa tcccagaagc ggtttatctt gaagcgagat aactctagta 841 ttgataaaga agacaatcag caaaacagaa tgcatccatt tagagatgac agacgaagta 901 aatcaattga agagagagaa gaggaatatc agagagtgag ggagagaata tttgcacacg 961 attcagtttg ctcccaggaa agcctttttg tggaaaacag taggctcttg gaagacagta 1021 acatgagcaa ggagacctat aagaaaagac agctctttcg gggcaacaga gatggctcag 1081 ggagaacatc tgggagtcga cagagcagct cagaaaatga actcaagtgg tctgaccacc 1141 aaagggcctg gagcagcaca gactccgaca gttccaaccg caatctaaag cccgccatga 1201 ccaagacggc gagttttggg ggcatcacgg tgctgaccag gggtgacagc acttccagta 1261 ctaggagtac cgggaagctg tccaaagcag gttccgagtc ttccagcagt gcaggctcct 1321 caggatcgct gtcccgcacc catccacctc tccagagcac acccctagtc tcaggtgtgg 1381 cagctggctc tccaggctgt gtgccttatc cagagaatgg aatagggggc caggttgctc 1441 ccagcagcac cagctacatc ctccttccac ttgaagctgc aacaggcatc ccgcctggaa 1501 gcatccttct taatccacac acaggccagc cctttgtgaa tcccgatgga actcctgcaa 1561 tatacaaccc acccaccagt cagcagcccc tgcgaagcgc catggtgggg cagtcccaac 1621 agcagccacc acagcagcag ccctccccgc agccccaaca gcaggtccag ccaccgcagc 1681 cacagatggc aggccctctg gtcactcaga gagatgatgt ggcaacacag tttggccaga 1741 tgaccctgag ccggcagtcc tcgggggaga ctcctgaacc cccatcaggt cctgtctacc 1801 catcctccct tatgccacag ccggcccagc agcccagcta tgtaatcgcc tctacaggcc 1861 agcagcttcc tacaggagga ttctcaggct ctggccctcc catctcccag caggtcctcc 1921 agccccctcc ctcaccacag ggatttgtgc aacagcctcc gcctgcacag atgcctgtat 1981 attattaccc atctggtcag taccctacct caaccacgca acagtaccgg cccatggccc 2041 cggttcagta caacgctcag aggagtcaac agatgccaca ggcagcacag caagcaggtt 2101 accagccagt cttgtctggt caacagggat tccaaggcct aataggagtg cagcagccac 2161 ctcagagtca gaacgtGATA AATAACCAAC AAGGAACTCC GGTGCAAAGC GTGATGGTTT 2221 CCTACCCAAC AATGTCTTCT TATCAGGTGC CAATGACCCA GGGTTCTCAA GGACTGCCCC 2281 AGCAGTCATA CCAACAGCCA ATCATGCTAC CTAACCAGGC AGGTCAAGGG TCACTCCCAG 2341 CCACTGGAAT GCCTGTTTAC TGTAATGTCA CACCGCCCAC CCCTCAGAAC AACCTTAGGC 2401 TGATTGGCCC ACACTGCCCC TCCAGCACTG TCCCAGTGAT GTCAGCTAGC TGCAGAACAA 2461 ACTGTGCAAG TATGAGCAAT GCTGGTTGGC AGGTCAAATT CTGCCCAACT TTCTTGTACA 2521 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 2581 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 2641 AGGACGATCC ATTGAACCTA TCGGGTCTCC CACGCGTTAA GTCgacaatc aacctctgga 2701 ttacaaaatt tgtgaaagat t