Transcript: Mouse XM_006512333.2

PREDICTED: Mus musculus cyclic AMP-regulated phosphoprotein, 21 (Arpp21), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arpp21 (74100)
Length:
3342
CDS:
304..2835

Additional Resources:

NCBI RefSeq record:
XM_006512333.2
NBCI Gene record:
Arpp21 (74100)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512333.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080573 GCTGGTTAATGGTGCATAATT pLKO.1 2996 3UTR 100% 15.000 21.000 N Arpp21 n/a
2 TRCN0000080575 CCCGGAAGCATCCTTCTTAAT pLKO.1 1723 CDS 100% 13.200 18.480 N Arpp21 n/a
3 TRCN0000080574 CGGTTTATCTTGAAGCGAGAT pLKO.1 1045 CDS 100% 4.050 5.670 N Arpp21 n/a
4 TRCN0000178449 GAAGAGTCTTCAGCTAGATCT pLKO.1 517 CDS 100% 4.950 3.465 N Arpp21 n/a
5 TRCN0000178646 CATCCTCAAGTCAGAAAGTCT pLKO.1 381 CDS 100% 3.000 2.100 N Arpp21 n/a
6 TRCN0000181350 CAGAAGTCTTGCTGTCTGTGA pLKO.1 498 CDS 100% 2.640 1.848 N Arpp21 n/a
7 TRCN0000198055 CTCAAGTCAGAAAGTCTGGAT pLKO.1 385 CDS 100% 2.640 1.848 N Arpp21 n/a
8 TRCN0000080576 GCAGGAAATGATTGATTTCAT pLKO.1 813 CDS 100% 0.563 0.394 N Arpp21 n/a
9 TRCN0000181662 GCTGTCTGTGAAGAGTCTTCA pLKO.1 508 CDS 100% 4.950 2.970 N Arpp21 n/a
10 TRCN0000080577 CCCTCAGAACAACCTAAGGTT pLKO.1 2712 CDS 100% 3.000 1.800 N Arpp21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512333.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14976 pDONR223 61.8% 82.3% 82.8% None (many diffs) n/a
2 ccsbBroad304_14976 pLX_304 0% 82.3% 82.8% V5 (many diffs) n/a
3 TRCN0000480701 TCCATTGAACCTATCGGGTCTCCC pLX_317 13.6% 82.3% 82.8% V5 (many diffs) n/a
Download CSV