Transcript: Human XM_017005591.2

PREDICTED: Homo sapiens cAMP regulated phosphoprotein 21 (ARPP21), transcript variant X26, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARPP21 (10777)
Length:
4069
CDS:
1087..3531

Additional Resources:

NCBI RefSeq record:
XM_017005591.2
NBCI Gene record:
ARPP21 (10777)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005591.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232727 TCCAGAGAACGGCATTGTTAA pLKO_005 1155 CDS 100% 13.200 18.480 N ARPP21 n/a
2 TRCN0000080574 CGGTTTATCTTGAAGCGAGAT pLKO.1 1831 CDS 100% 4.050 3.240 N Arpp21 n/a
3 TRCN0000082665 ACTCCAGAGAACGGCATTGTT pLKO.1 1153 CDS 100% 5.625 3.938 N ARPP21 n/a
4 TRCN0000082664 AGGCTCAGAATCAAGAAAGAA pLKO.1 1226 CDS 100% 5.625 3.938 N ARPP21 n/a
5 TRCN0000082666 GCTGTCTGTGAGGAATCTTCT pLKO.1 1294 CDS 100% 4.950 3.465 N ARPP21 n/a
6 TRCN0000232729 TGCTGTCTGTGAGGAATCTTC pLKO_005 1293 CDS 100% 4.950 3.465 N ARPP21 n/a
7 TRCN0000082667 GAGGTGAAAGTCTTCAGGATC pLKO.1 1325 CDS 100% 4.050 2.835 N ARPP21 n/a
8 TRCN0000232728 GGAGGCTCAGAATCAAGAAAG pLKO_005 1224 CDS 100% 10.800 6.480 N ARPP21 n/a
9 TRCN0000232730 TGAAAGTCTTCAGGATCAGAC pLKO_005 1329 CDS 100% 4.050 2.835 N ARPP21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005591.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14976 pDONR223 61.8% 91.5% 91.2% None (many diffs) n/a
2 ccsbBroad304_14976 pLX_304 0% 91.5% 91.2% V5 (many diffs) n/a
3 TRCN0000480701 TCCATTGAACCTATCGGGTCTCCC pLX_317 13.6% 91.5% 91.2% V5 (many diffs) n/a
Download CSV