Construct: ORF TRCN0000480769
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010431.1_s317c1
- Derived from:
- ccsbBroadEn_09886
- DNA Barcode:
- CAAGTACGATGCCTACATATAACA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SPDYA (245711)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480769
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 245711 | SPDYA | speedy/RINGO cell cycle reg... | NM_001142634.2 | 99.8% | 100% | 379C>T |
| 2 | human | 245711 | SPDYA | speedy/RINGO cell cycle reg... | NM_182756.4 | 99.8% | 100% | 379C>T |
| 3 | human | 245711 | SPDYA | speedy/RINGO cell cycle reg... | NM_001008779.1 | 91% | 90.4% | (many diffs) |
| 4 | mouse | 70891 | Spdya | speedy/RINGO cell cycle reg... | NM_029254.1 | 86.7% | 83.3% | (many diffs) |
| 5 | mouse | 70891 | Spdya | speedy/RINGO cell cycle reg... | XM_006524907.2 | 86.7% | 83.3% | (many diffs) |
| 6 | mouse | 70891 | Spdya | speedy/RINGO cell cycle reg... | XM_006524908.2 | 86.7% | 83.3% | (many diffs) |
| 7 | mouse | 70891 | Spdya | speedy/RINGO cell cycle reg... | XM_011246602.2 | 86.7% | 83.3% | (many diffs) |
| 8 | mouse | 70891 | Spdya | speedy/RINGO cell cycle reg... | NM_001142631.1 | 79.4% | 76.3% | (many diffs) |
| 9 | mouse | 70891 | Spdya | speedy/RINGO cell cycle reg... | XM_006524909.3 | 62.7% | 60.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1008
- ORF length:
- 939
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gaggcacaat cagatgtgtt gtgagacacc acctactgtc actgtttatg 121 taaaatcagg gtcaaataga tcacatcagc ctaaaaagcc cattactctg aagcgtccta 181 tttgtaaaga taattggcaa gcatttgaaa aaaatacaca taataacaac aaatctaaac 241 gccccaaagg accttgtctg gttatacagc gtcaggatat gactgctttc tttaaattat 301 ttgatgacga tttaattcaa gatttcttgt ggatggactg ctgctgtaaa attgcagaca 361 agtatctttt ggctatgacc tttgtttatt tcaagagggc taaatttact ataagtgagc 421 ataccaggat aaatttcttt attgctttgt atctggctaa tacagttgaa gaagatgaag 481 aagaaaccaa gtacgaaatt tttccatggg ctttagggaa aaactggaga aaattgttcc 541 ctaatttctt aaagttaagg gaccagctct gggatagaat tgactatagg gctattgtaa 601 gcaggcgatg ttgtgaggag gttatggCCA TTGCACCAAC CCATTATATC TGGCAAAGAG 661 AACGTTCTGT TCATCACAGT GGAGCTGTCA GAAACTACAA CAGAGATGAA GTTCAGCTGC 721 CCCGGGGACC TAGTGCCACA CCAGTAGATT GTTCACTCTG TGGTAAAAAA AGAAGATATG 781 TTAGACTGGG ATTGTCTTCA TCATCATCTT TATCCAGTCA TACAGCAGGG GTGACAGAAA 841 AACATTCTCA GGACTCATAC AACTCACTGT CAATGGACAT AATAGGTGAT CCTTCTCAAG 901 CTTATACTGG TTCTGAAGTA GTCAATGACC ATCAATCAAA TAAAGGAAAG AAAACTAATT 961 TCTTGAAGAA AGACAAATCT ATGGAGTGGT TTACAGGAAG TGAAGAATTG CCAACTTTCT 1021 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1081 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1141 GTGGAAAGGA CGACAAGTAC GATGCCTACA TATAACAACG CGTTAAGTCg acaatcaacc 1201 tctggattac aaaatttgtg aaagatt