Transcript: Human NM_001142634.2

Homo sapiens speedy/RINGO cell cycle regulator family member A (SPDYA), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
SPDYA (245711)
Length:
1743
CDS:
133..1074

Additional Resources:

NCBI RefSeq record:
NM_001142634.2
NBCI Gene record:
SPDYA (245711)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001142634.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241245 TGAGCATACCAGGATAAATTT pLKO_005 480 CDS 100% 15.000 21.000 N Spdya n/a
2 TRCN0000241246 GAATTGACTATAGGGCTATTG pLKO_005 641 CDS 100% 10.800 15.120 N Spdya n/a
3 TRCN0000416104 GAATTGACTATAGGGCTATTG pLKO_005 641 CDS 100% 10.800 15.120 N SPDYA n/a
4 TRCN0000133654 GTGATCCTTCTCAAGCTTATA pLKO.1 950 CDS 100% 13.200 9.240 N SPDYA n/a
5 TRCN0000241249 TGCTCTGTATCTGGCTAATAC pLKO_005 507 CDS 100% 13.200 9.240 N Spdya n/a
6 TRCN0000423325 CGATGTTGTGAGGAGGTTATG pLKO_005 670 CDS 100% 10.800 7.560 N SPDYA n/a
7 TRCN0000134127 CAAAGAGAACGTTCTGTTCAT pLKO.1 718 CDS 100% 4.950 3.465 N SPDYA n/a
8 TRCN0000136058 GAGTGGTTTACAGGAAGTGAA pLKO.1 1048 CDS 100% 4.950 3.465 N SPDYA n/a
9 TRCN0000134331 GAAGAAGAAACCAAGTACGAA pLKO.1 541 CDS 100% 3.000 2.100 N SPDYA n/a
10 TRCN0000136164 GCTGTCAGAAACTACAACAGA pLKO.1 748 CDS 100% 3.000 2.100 N SPDYA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142634.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09886 pDONR223 100% 99.8% 100% None 379C>T n/a
2 ccsbBroad304_09886 pLX_304 0% 99.8% 100% V5 379C>T n/a
3 TRCN0000480769 CAAGTACGATGCCTACATATAACA pLX_317 40.6% 99.8% 100% V5 379C>T n/a
Download CSV