Transcript: Mouse XM_006524907.2

PREDICTED: Mus musculus speedy/RINGO cell cycle regulator family, member A (Spdya), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Spdya (70891)
Length:
1384
CDS:
70..1002

Additional Resources:

NCBI RefSeq record:
XM_006524907.2
NBCI Gene record:
Spdya (70891)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524907.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241248 ATTAGTCTGAAACGTCCTATT pLKO_005 163 CDS 100% 10.800 15.120 N Spdya n/a
2 TRCN0000241245 TGAGCATACCAGGATAAATTT pLKO_005 414 CDS 100% 15.000 10.500 N Spdya n/a
3 TRCN0000241249 TGCTCTGTATCTGGCTAATAC pLKO_005 441 CDS 100% 13.200 9.240 N Spdya n/a
4 TRCN0000241246 GAATTGACTATAGGGCTATTG pLKO_005 575 CDS 100% 10.800 7.560 N Spdya n/a
5 TRCN0000416104 GAATTGACTATAGGGCTATTG pLKO_005 575 CDS 100% 10.800 7.560 N SPDYA n/a
6 TRCN0000241247 GAGGGCCTTGTCTAATCATAC pLKO_005 245 CDS 100% 10.800 7.560 N Spdya n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524907.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09886 pDONR223 100% 86.7% 83.3% None (many diffs) n/a
2 ccsbBroad304_09886 pLX_304 0% 86.7% 83.3% V5 (many diffs) n/a
3 TRCN0000480769 CAAGTACGATGCCTACATATAACA pLX_317 40.6% 86.7% 83.3% V5 (many diffs) n/a
Download CSV