Construct: ORF TRCN0000480892
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010208.1_s317c1
- Derived from:
- ccsbBroadEn_00667
- DNA Barcode:
- TGCCGTTGGGGGCACTTGTAAGAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GPM6A (2823)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480892
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2823 | GPM6A | glycoprotein M6A | NM_005277.4 | 100% | 100% | |
| 2 | human | 2823 | GPM6A | glycoprotein M6A | NM_201591.2 | 100% | 100% | |
| 3 | human | 2823 | GPM6A | glycoprotein M6A | NM_001261448.1 | 97.1% | 95.6% | (many diffs) |
| 4 | human | 2823 | GPM6A | glycoprotein M6A | NM_201592.2 | 95.8% | 95.6% | 0_1ins33;2_3delTGinsAA |
| 5 | human | 2823 | GPM6A | glycoprotein M6A | XM_006714183.1 | 77.3% | 77.3% | 0_1ins189 |
| 6 | human | 2823 | GPM6A | glycoprotein M6A | XM_011531877.1 | 77.3% | 77.3% | 0_1ins189 |
| 7 | human | 2823 | GPM6A | glycoprotein M6A | NM_001261447.1 | 68.1% | 55.3% | (many diffs) |
| 8 | mouse | 234267 | Gpm6a | glycoprotein m6a | NM_153581.6 | 91.9% | 98.9% | (many diffs) |
| 9 | mouse | 234267 | Gpm6a | glycoprotein m6a | NM_001253754.1 | 88% | 94.6% | (many diffs) |
| 10 | mouse | 234267 | Gpm6a | glycoprotein m6a | NM_001253756.1 | 59.8% | 63.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 900
- ORF length:
- 834
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga agagaatatg gaagagggac agacacaaaa agggtgtttt gaatgctgta 121 tcaaatgcct ggggggcatt ccctatgcct ctctgattgc caccatcctg ctctatgcgg 181 gtgttgccct gttctgtggc tgcggtcatg aagcgctttc tggaactgtc aacattctgc 241 aaacctactt tgagatggca agaactgctg gagacacact ggatgttttt accatgattg 301 acatctttaa gtatgtgatc tacggcatcg cagctgcgtt ctttgtgtat ggcattttgc 361 tgatggtgga aggtttcttc acaactgggg ccatcaaaga tctctatggg gatttcaaaa 421 tcaccacttg tggcagatgt gtgagcgctt ggttcattat gctgacatat cttttcatgt 481 tggCCTGGCT GGGAGTCACG GCTTTCACCT CACTGCCAGT TTACATGTAC TTCAATCTGT 541 GGACCATCTG CCGGAACACC ACATTAGTGG AGGGAGCAAA TCTCTGCTTG GACCTTCGTC 601 AGTTTGGAAT TGTGACAATT GGAGAGGAAA AGAAAATTTG TACTGTCTCT GAGAATTTCT 661 TGAGGATGTG CGAATCTACT GAGCTGAACA TGACCTTCCA CTTGTTTATT GTGGCACTTG 721 CTGGAGCTGG GGCAGCAGTC ATTGCTATGG TTCACTACCT TATGGTTCTG TCTGCCAACT 781 GGGCCTATGT GAAAGACGCC TGCCGGATGC AGAAGTATGA AGACATCAAG TCGAAGGAAG 841 AGCAAGAGCT TCATGACATC CACTCTACTC GCTCCAAAGA GCGGCTCAAT GCATACACAT 901 ACCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 961 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1021 TTTATATATC TTGTGGAAAG GACGATGCCG TTGGGGGCAC TTGTAAGACA CGCGTTAAGT 1081 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt