Transcript: Mouse NM_153581.6

Mus musculus glycoprotein m6a (Gpm6a), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Gpm6a (234267)
Length:
3351
CDS:
552..1388

Additional Resources:

NCBI RefSeq record:
NM_153581.6
NBCI Gene record:
Gpm6a (234267)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153581.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000442062 CATGATGACTCCGCTTGATAT pLKO_005 1862 3UTR 100% 13.200 18.480 N Gpm6a n/a
2 TRCN0000446571 TTAACATTGTCCAACGCAAAT pLKO_005 1658 3UTR 100% 10.800 15.120 N Gpm6a n/a
3 TRCN0000091039 CCCGTGTACATGTATTTCAAT pLKO.1 1002 CDS 100% 5.625 7.875 N Gpm6a n/a
4 TRCN0000091038 CCTCCCACATATCACACATAA pLKO.1 1699 3UTR 100% 13.200 10.560 N Gpm6a n/a
5 TRCN0000445181 GCTCAATGCGTACACATAAAT pLKO_005 1370 CDS 100% 15.000 10.500 N Gpm6a n/a
6 TRCN0000440377 GCTTCGAGTGCTGCATTAAAT pLKO_005 592 CDS 100% 15.000 10.500 N Gpm6a n/a
7 TRCN0000091040 CCTTTCTGGAACAGTCAACAT pLKO.1 701 CDS 100% 4.950 3.465 N Gpm6a n/a
8 TRCN0000091041 GCTGACATACCTCTTCATGTT pLKO.1 947 CDS 100% 4.950 3.465 N Gpm6a n/a
9 TRCN0000091042 GTGTGAATCTACTGAGCTGAA pLKO.1 1154 CDS 100% 4.050 2.835 N Gpm6a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153581.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00667 pDONR223 100% 91.9% 98.9% None (many diffs) n/a
2 ccsbBroad304_00667 pLX_304 0% 91.9% 98.9% V5 (many diffs) n/a
3 TRCN0000480892 TGCCGTTGGGGGCACTTGTAAGAC pLX_317 50% 91.9% 98.9% V5 (many diffs) n/a
4 ccsbBroadEn_06306 pDONR223 100% 91.8% 98.5% None (many diffs) n/a
5 ccsbBroad304_06306 pLX_304 0% 91.8% 98.5% V5 (many diffs) n/a
6 TRCN0000467688 TTCCTTCCTGGTTCATGCAGAGAT pLX_317 51.1% 91.8% 98.5% V5 (many diffs) n/a
Download CSV