Construct: ORF TRCN0000480910
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003063.1_s317c1
- Derived from:
- ccsbBroadEn_06657
- DNA Barcode:
- TAATACCCTGATATCACACCTGAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NPY5R (4889)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480910
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4889 | NPY5R | neuropeptide Y receptor Y5 | NM_001317091.1 | 99.9% | 99.7% | 115G>T |
| 2 | human | 4889 | NPY5R | neuropeptide Y receptor Y5 | NM_001317092.1 | 99.9% | 99.7% | 115G>T |
| 3 | human | 4889 | NPY5R | neuropeptide Y receptor Y5 | NM_006174.4 | 99.9% | 99.7% | 115G>T |
| 4 | human | 4889 | NPY5R | neuropeptide Y receptor Y5 | XM_005263038.3 | 99.9% | 99.7% | 115G>T |
| 5 | human | 4889 | NPY5R | neuropeptide Y receptor Y5 | XM_011532017.2 | 99.9% | 99.7% | 115G>T |
| 6 | human | 4889 | NPY5R | neuropeptide Y receptor Y5 | XM_011532015.2 | 98.3% | 98.2% | 1_21del;136G>T |
| 7 | human | 4889 | NPY5R | neuropeptide Y receptor Y5 | XM_017008255.1 | 98.3% | 98.2% | 1_21del;136G>T |
| 8 | human | 4889 | NPY5R | neuropeptide Y receptor Y5 | XM_017008256.1 | 98.3% | 98.2% | 1_21del;136G>T |
| 9 | mouse | 18168 | Npy5r | neuropeptide Y receptor Y5 | NM_016708.3 | 81.3% | 84.7% | (many diffs) |
| 10 | mouse | 18168 | Npy5r | neuropeptide Y receptor Y5 | XM_006509598.3 | 81.3% | 84.7% | (many diffs) |
| 11 | mouse | 18168 | Npy5r | neuropeptide Y receptor Y5 | XM_006509599.3 | 81.3% | 84.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1404
- ORF length:
- 1335
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggatttagag ctcgacgagt attataacaa gacacttgcc acagagaata 121 atactgctgc cactcggaat tctgatttcc cagtctggga tgactataaa agcagtgtag 181 attacttaca gtattttctg attgggctct atacatttgt aagtcttctt ggctttatgg 241 ggaatctact tattttaatg gctctcatga aaaagcgtaa tcagaagact acggtaaact 301 tcctcatagg caatctggcc ttttctgata tcttggttgt gctgttttgc tcacctttca 361 cactgacgtc tgtcttgctg gatcagtgga tgtttggcaa agtcatgtgc catattatgc 421 cttttcttca atgtgtgtca gttttggttt caactttaat tttaatatca attgccattg 481 tcaggtatca tatgataaaa catcccatat ctaataattt aacagcaaac catggctact 541 ttctgatagc tactgtctgg acactaggtt ttgccatctg ttctcccctt ccagtgtttc 601 acagtcttgt ggaacttcaa gaaacatttg gttcagcatt gctgagcagc aggtatttat 661 gtgttgagtc atggccatct gattcataca gaattgcctt tactatctct ttattgctag 721 ttcagtatat tctgccctta gtttgtctta ctgtaagtca tacaagtgtc tgcagaagta 781 taagctgtgg attgtccaac aaagaaaaca gacttgaaga aaatgagatg atcaacttaa 841 ctcttcatcc atccaaaaag agtgggcctc aggtgaaact ctctggcagc cataaatgga 901 gttattcatt catcaaaaaa cacagaagaa gatatagcaa gaagacagca tgtgtgttac 961 ctgctccaga aagaccttct caagagaacc actccagaat acttccagaa aactttggct 1021 ctgtaagaag tcagctctct tcatccagta agttcatacc aggggtcccc acttgcttTG 1081 AGATAAAACC TGAAGAAAAT TCAGATGTTC ATGAATTGAG AGTAAAACGT TCTGTTACAA 1141 GAATAAAAAA GAGATCTCGA AGTGTTTTCT ACAGACTGAC CATACTGATA TTAGTATTTG 1201 CTGTTAGTTG GATGCCACTA CACCTTTTCC ATGTGGTAAC TGATTTTAAT GACAATCTTA 1261 TTTCAAATAG GCATTTCAAG TTGGTGTATT GCATTTGTCA TTTGTTGGGC ATGATGTCCT 1321 GTTGTCTTAA TCCAATTCTA TATGGGTTTC TTAATAATGG GATTAAAGCT GATTTAGTGT 1381 CCCTTATACA CTGTCTTCAT ATGTTGCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1441 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1501 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAT AATACCCTGA 1561 TATCACACCT GATACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1621 att