Transcript: Human XM_017008256.1

PREDICTED: Homo sapiens neuropeptide Y receptor Y5 (NPY5R), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NPY5R (4889)
Length:
9325
CDS:
7301..8659

Additional Resources:

NCBI RefSeq record:
XM_017008256.1
NBCI Gene record:
NPY5R (4889)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008256.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357667 TTGCTGAGCAGCAGGTATTTA pLKO_005 7892 CDS 100% 15.000 12.000 N NPY5R n/a
2 TRCN0000009220 CCTTAGTTTGTCTTACTGTAA pLKO.1 7989 CDS 100% 4.950 3.960 N NPY5R n/a
3 TRCN0000357668 CCAGTCTGGGATGACTATAAA pLKO_005 7403 CDS 100% 15.000 10.500 N NPY5R n/a
4 TRCN0000009218 CCACTTCCATGTTGTCTTATA pLKO.1 8913 3UTR 100% 13.200 9.240 N NPY5R n/a
5 TRCN0000009222 GCAGCCATAAATGGAGTTATT pLKO.1 8139 CDS 100% 13.200 9.240 N NPY5R n/a
6 TRCN0000009221 GCTGATTTAGTGTCCCTTATA pLKO.1 8621 CDS 100% 13.200 9.240 N NPY5R n/a
7 TRCN0000009219 GCCATCTGATTCATACAGAAT pLKO.1 7927 CDS 100% 4.950 3.465 N NPY5R n/a
8 TRCN0000357669 AGACTGACCATACTGATATTA pLKO_005 8426 CDS 100% 15.000 9.000 N NPY5R n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6016 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008256.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489435 GCGGTCTGTCCATCACTCAGCATT pLX_317 25.5% 98.4% 98.4% V5 (not translated due to prior stop codon) 1_21del n/a
2 ccsbBroadEn_06657 pDONR223 100% 98.3% 98.2% None 1_21del;136G>T n/a
3 ccsbBroad304_06657 pLX_304 0% 98.3% 98.2% V5 1_21del;136G>T n/a
4 TRCN0000480910 TAATACCCTGATATCACACCTGAT pLX_317 24.7% 98.3% 98.2% V5 1_21del;136G>T n/a
5 TRCN0000488102 TATCTGAATGTGGGGGTCGCTCCC pLX_317 24% 97% 96.7% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000489509 GACCACATAGTGCCGTTTCGGAGA pLX_317 25.5% 87.6% 98.4% V5 (not translated due to prior stop codon) 0_1ins186;3G>T;9_9delCinsAAG n/a
Download CSV