Transcript: Mouse XM_006509598.3

PREDICTED: Mus musculus neuropeptide Y receptor Y5 (Npy5r), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Npy5r (18168)
Length:
2875
CDS:
706..2106

Additional Resources:

NCBI RefSeq record:
XM_006509598.3
NBCI Gene record:
Npy5r (18168)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509598.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220268 GCGTTCCCTCACGAGAATAAA pLKO.1 1824 CDS 100% 15.000 21.000 N Npy5r n/a
2 TRCN0000220267 GCACCCTATATCTAACAATTT pLKO.1 1200 CDS 100% 13.200 10.560 N Npy5r n/a
3 TRCN0000220265 CGACTTACAATACTTCCTGAT pLKO.1 882 CDS 100% 4.050 3.240 N Npy5r n/a
4 TRCN0000220264 CCGATCTTATATGGATTCCTT pLKO.1 2029 CDS 100% 3.000 2.100 N Npy5r n/a
5 TRCN0000220266 GCCCTCTGATTCATACAGAAT pLKO.1 1374 CDS 100% 4.950 2.970 N Npy5r n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509598.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489435 GCGGTCTGTCCATCACTCAGCATT pLX_317 25.5% 81.4% 85% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_06657 pDONR223 100% 81.3% 84.7% None (many diffs) n/a
3 ccsbBroad304_06657 pLX_304 0% 81.3% 84.7% V5 (many diffs) n/a
4 TRCN0000480910 TAATACCCTGATATCACACCTGAT pLX_317 24.7% 81.3% 84.7% V5 (many diffs) n/a
5 TRCN0000488102 TATCTGAATGTGGGGGTCGCTCCC pLX_317 24% 78.4% 82.1% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000489509 GACCACATAGTGCCGTTTCGGAGA pLX_317 25.5% 70.8% 85% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV