Construct: ORF TRCN0000480920
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018298.1_s317c1
- Derived from:
- ccsbBroadEn_05179
- DNA Barcode:
- AGATATCTTATCCTTTTCTTTAAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- THAP8 (199745)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480920
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 199745 | THAP8 | THAP domain containing 8 | NM_152658.3 | 100% | 100% | |
2 | human | 199745 | THAP8 | THAP domain containing 8 | NM_001331102.1 | 85% | 85% | 548_549ins123 |
3 | human | 199745 | THAP8 | THAP domain containing 8 | NM_001331103.1 | 84.3% | 84.3% | 0_1ins129 |
4 | human | 199745 | THAP8 | THAP domain containing 8 | NM_001331104.1 | 84.3% | 84.3% | 0_1ins129 |
5 | human | 199745 | THAP8 | THAP domain containing 8 | NR_138539.1 | 34.4% | 1_545del;628_629ins193;1175_1632del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 888
- ORF length:
- 822
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc caagtactgc agggcgccga actgctccaa cactgcgggc cgcctgggtg 121 cagacaaccg ccctgtgagc ttctacaagt tcccactgaa ggatggtccc cggctgcagg 181 cctggctgca gcacatgggc tgtgagcact gggtgcccag ctgccaccag cacttgtgca 241 gcgagcactt cacaccctcc tgcttccagt ggcgctgggg tgtgcgctac ctgcggcctg 301 atgcagtgcc ctccatcttc tcccggggac cacctgccaa gagtcagcgg aggacccgaa 361 gcacccagaa gccagtctcg ccgccgcctc ccctacagaa gaatacaccc ctgccccaga 421 gccctgccat cccagtctct ggcccagtgc gcctagtggt gctgggcccc acatcgggga 481 gccccaagac tgtggccacc atgctcctga cccccctggc ccctgcgcca actccTGAGC 541 GGTCACAACC TGAAGTCCCT GCCCAACAGG CCCAGACCGG GCTGGGCCCA GTGCTGGGAG 601 CACTGCAACG CCGGGTGCGG AGGCTGCAAC GGTGCCAGGA GCGGCACCAG GCGCAGCTGC 661 AGGCCCTGGA ACGGCTGGCA CAGCAGCTAC ACGGGGAGAG CCTGCTGGCA CGGGCACGCC 721 GGGGTCTGCA GCGCCTGACA ACAGCCCAGA CCCTTGGACC TGAGGAATCC CAAACCTTCA 781 CCATCATCTG TGGAGGGCCT GACATAGCCA TGGTCCTTGC CCAGGACCCT GCACCTGCCA 841 CAGTGGATGC CAAGCCGGAG CTCCTGGACA CTCGGATCCC CAGTGCATAC CCAACTTTCT 901 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 961 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1021 GTGGAAAGGA CGAAGATATC TTATCCTTTT CTTTAAGACG CGTTAAGTCg acaatcaacc 1081 tctggattac aaaatttgtg aaagatt