Construct: ORF TRCN0000480951
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002085.2_s317c1
- Derived from:
- ccsbBroadEn_10717
- DNA Barcode:
- AATTTGATCGGACCTGGTGAGCTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SCARB1 (949)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480951
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 949 | SCARB1 | scavenger receptor class B ... | NM_001367981.1 | 99.9% | 100% | 1050T>C |
| 2 | human | 949 | SCARB1 | scavenger receptor class B ... | NM_001367982.1 | 92.1% | 92% | (many diffs) |
| 3 | human | 949 | SCARB1 | scavenger receptor class B ... | NM_001082959.2 | 90% | 85.4% | (many diffs) |
| 4 | human | 949 | SCARB1 | scavenger receptor class B ... | NM_001367989.1 | 87.5% | 84.9% | (many diffs) |
| 5 | human | 949 | SCARB1 | scavenger receptor class B ... | NM_005505.5 | 87.5% | 84.9% | (many diffs) |
| 6 | human | 949 | SCARB1 | scavenger receptor class B ... | NM_001367983.1 | 87.2% | 84.6% | (many diffs) |
| 7 | human | 949 | SCARB1 | scavenger receptor class B ... | NM_001367984.1 | 86.8% | 84.6% | (many diffs) |
| 8 | human | 949 | SCARB1 | scavenger receptor class B ... | NM_001367985.1 | 86.1% | 83.5% | (many diffs) |
| 9 | human | 949 | SCARB1 | scavenger receptor class B ... | NM_001367986.1 | 83.9% | 81.5% | (many diffs) |
| 10 | human | 949 | SCARB1 | scavenger receptor class B ... | NM_001367987.1 | 78.1% | 73.6% | (many diffs) |
| 11 | human | 949 | SCARB1 | scavenger receptor class B ... | NM_001367988.1 | 63.7% | 61% | (many diffs) |
| 12 | human | 949 | SCARB1 | scavenger receptor class B ... | NR_160424.1 | 47% | (many diffs) | |
| 13 | human | 949 | SCARB1 | scavenger receptor class B ... | NR_160416.1 | 46.4% | (many diffs) | |
| 14 | human | 949 | SCARB1 | scavenger receptor class B ... | NR_160417.1 | 45.2% | (many diffs) | |
| 15 | human | 949 | SCARB1 | scavenger receptor class B ... | NR_160419.1 | 44.2% | (many diffs) | |
| 16 | human | 949 | SCARB1 | scavenger receptor class B ... | NR_160420.1 | 43.7% | (many diffs) | |
| 17 | human | 949 | SCARB1 | scavenger receptor class B ... | NR_160422.1 | 43% | (many diffs) | |
| 18 | human | 949 | SCARB1 | scavenger receptor class B ... | NR_160423.1 | 42.9% | (many diffs) | |
| 19 | human | 949 | SCARB1 | scavenger receptor class B ... | NR_160421.1 | 41.4% | (many diffs) | |
| 20 | human | 949 | SCARB1 | scavenger receptor class B ... | NR_160418.1 | 37.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1722
- ORF length:
- 1656
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg ctgctccgcc aaagcgcgct gggctgccgg ggcgctgggc gtcgcggggc 121 tactgtgcgc tgtgctgggc gctgtcatga tcgtgatggt gccgtcgctc atcaagcagc 181 aggtccttaa gaacgtgcgc atcgacccca gtagcctgtc cttcaacatg tggaaggaga 241 tccctatccc cttctatctc tccgtctact tctttgacgt catgaacccc agcgagatcc 301 tgaagggcga gaagccgcag gtgcgggagc gcgggcccta cgtgtacagg gagttcaggc 361 acaaaagcaa catcaccttc aacaacaacg acaccgtgtc cttcctcgag taccgcacct 421 tccagttcca gccctccaag tcccacggct cggagagcga ctacatcgtc atgcccaaca 481 tcctggtctt gggtgcggcg gtgatgatgg agaataagcc catgaccctg aagctcatca 541 tgaccttggc attcaccacc ctcggcgaac gtgccttcat gaaccgcact gtgggtgaga 601 tcatgtgggg ctacaaggac ccccttgtga atctcatcaa caagtacttt ccaggcatgt 661 tccccttcaa ggacaagttc ggattatttg ctgagctcaa caactccgac tctgggctct 721 tcacggtgtt cacgggggtc cagaacatca gcaggatcca cctcgtggac aagtggaacg 781 ggctgagcaa ggttgacttc tggcattccg atcagtgcaa catgatcaat ggaacttctg 841 ggcaaatgtg gccgcccttc atgactcctg agtcctcgct ggagttctac agcccggagg 901 cctgccgatc catgaagcta atgtacaagg agtcaggggt gtttgaaggc atccccacct 961 atcgcttcgt ggctcccaaa accctgtttg ccaacgggtc catctaccca cccaacgaag 1021 gcttctgccc gtgcctggag tctggaattc agaacgtcag cacctgcagg ttcagtgccc 1081 ccttgtttct ctcccatcct cacttcctca acgccgaccc ggttctggca gaagcggtga 1141 ctggcctgca ccctaaccag gaggcacact ccttgttcct ggacatccac ccggtcacgg 1201 gaatccccat gaactgctct gtgaaactgc agctgagcct ctacatgaaa tctgtcgcag 1261 gcattggaca aactgggaag attgagcctg tggtcctgcc gctgctctgg tttgcagaga 1321 gcggggccat ggagggggag actcttcaca CATTCTACAC TCAGCTGGTG TTGATGCCCA 1381 AGGTGATGCA CTATGCCCAG TACGTCCTCC TGGCGCTGGG CTGCGTCCTG CTGCTGGTCC 1441 CTGTCATCTG CCAAATCCGG AGCCAAGTAG GTGCTGGCCA GAGGGCAGCC CGGGCTGACA 1501 GCCATTCGCT TGCCTGCTGG GGGAAAGGGG CCTCAGATCG GACCCTCTGG CCAACCGCAG 1561 CCTGGAGCCC ACCTCCAGCA GCAGTCCTGC GTCTCTGCCG GAGTGGGAGC GGTCACTGCT 1621 GGGGGCTGCG CAGCACGCTT GCGTCTTTTG CATGCCGCGT TGCCACTACT CTGCCTGTTC 1681 TGGAAGGCCT GGGACCCTCC CTTGGAGGGG GCACAGGGTC CTGCCCAACT TTCTTGTACA 1741 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1801 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1861 AGGACGAAAT TTGATCGGAC CTGGTGAGCT GACGCGTTAA GTCgacaatc aacctctgga 1921 ttacaaaatt tgtgaaagat t