Transcript: Human NR_160419.1

Homo sapiens scavenger receptor class B member 1 (SCARB1), transcript variant 15, non-coding RNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SCARB1 (949)
Length:
3331
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_160419.1
NBCI Gene record:
SCARB1 (949)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_160419.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056963 GCCAAGAGAAATGCTATTTAT pLKO.1 1467 3UTR 100% 15.000 21.000 N SCARB1 n/a
2 TRCN0000310483 GCCAAGAGAAATGCTATTTAT pLKO_005 1467 3UTR 100% 15.000 21.000 N SCARB1 n/a
3 TRCN0000056967 CTTCTATCTCTCCGTCTACTT pLKO.1 330 3UTR 100% 4.950 3.465 N SCARB1 n/a
4 TRCN0000299709 CTTCTATCTCTCCGTCTACTT pLKO_005 330 3UTR 100% 4.950 3.465 N SCARB1 n/a
5 TRCN0000056965 CGGATTATTTGCTGAGCTCAA pLKO.1 759 3UTR 100% 4.050 2.835 N SCARB1 n/a
6 TRCN0000056966 GCAAGGTTGACTTCTGGCATT pLKO.1 866 3UTR 100% 4.050 2.835 N SCARB1 n/a
7 TRCN0000299698 GCAAGGTTGACTTCTGGCATT pLKO_005 866 3UTR 100% 4.050 2.835 N SCARB1 n/a
8 TRCN0000056964 GCTCATCATGACCTTGGCATT pLKO.1 612 3UTR 100% 4.050 2.430 N SCARB1 n/a
9 TRCN0000310482 GCTCATCATGACCTTGGCATT pLKO_005 612 3UTR 100% 4.050 2.430 N SCARB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_160419.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10717 pDONR223 100% 44.2% None (many diffs) n/a
2 ccsbBroad304_10717 pLX_304 0% 44.2% V5 (many diffs) n/a
3 TRCN0000480951 AATTTGATCGGACCTGGTGAGCTG pLX_317 22.7% 44.2% V5 (many diffs) n/a
Download CSV