Construct: ORF TRCN0000481003
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011794.1_s317c1
- Derived from:
- ccsbBroadEn_11997
- DNA Barcode:
- AGGACAACCTCTTTTTGTCCTATG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SIRT6 (51548)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481003
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 51548 | SIRT6 | sirtuin 6 | NM_001321061.2 | 99.8% | 99.6% | 448C>T |
2 | human | 51548 | SIRT6 | sirtuin 6 | NM_001321058.2 | 90.3% | 90.1% | 314_394del;529C>T |
3 | human | 51548 | SIRT6 | sirtuin 6 | NM_001193285.3 | 77.9% | 77.7% | 1_216del;664C>T |
4 | human | 51548 | SIRT6 | sirtuin 6 | XM_024451539.1 | 77.2% | 77% | 1_144del;458_538del;673C>T |
5 | human | 51548 | SIRT6 | sirtuin 6 | NM_001321059.2 | 77% | 70.9% | (many diffs) |
6 | human | 51548 | SIRT6 | sirtuin 6 | NM_016539.4 | 72% | 71.8% | 1_216del;530_610del;745C>T |
7 | human | 51548 | SIRT6 | sirtuin 6 | NM_001321062.2 | 68% | 67.8% | 0_1ins189;125_205del;340C>T |
8 | human | 51548 | SIRT6 | sirtuin 6 | NM_001321064.1 | 58.3% | 38.2% | (many diffs) |
9 | human | 51548 | SIRT6 | sirtuin 6 | XM_024451540.1 | 58.3% | 38.2% | (many diffs) |
10 | human | 51548 | SIRT6 | sirtuin 6 | NM_001321063.2 | 46.9% | 23.6% | (many diffs) |
11 | human | 51548 | SIRT6 | sirtuin 6 | NM_001321060.2 | 46% | 30.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 834
- ORF length:
- 768
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ggagcgaggt ctggccccca agttcgacac cacctttgag agcgcgcggc 121 ccacgcagac ccacatggcg ctggtgcagc tggagcgcgt gggcctcctc cgcttcctgg 181 tcagccagaa cgtggacggg ctccatgtgc gctcaggctt ccccagggac aaactggcag 241 agctccacgg gaacatgttt gtggaagaat gtgccaagtg taagacgcag tacgtccgag 301 acacagtcgt gggcaccatg ggcctgaagg ccacgggccg gctctgcacc gtggctaagg 361 caagggggct gcgagcctgc aggaacgccg acctgtccat cacgctgggt acatcgctgc 421 agatccggcc cagcgggaac ctgccgctgg ctaccaagcg ccggggaggc cgcctggtca 481 tcgtcaacct gcagcccacc aagcacgacc gctatgctga cctccgcatc catggctacg 541 ttgacgaggt catgacccgg ctcatgaagc acctgGGGCT GGAGATCCCC GCCTGGGACG 601 GCCCCCGTGT GCTGGAGAGG GCGCTGCCAC CCCTGCCCCG CCCGCCCACC CCCAAGCTGG 661 AGCCCAAGGA GGAATCTCCC ACCCGGATCA ACGGCTCTAT CCCCGCCGGC CCCAAGCAGG 721 AGCCCTGCGC CCAGCACAAC GGCTCAGAGC CCGCCAGCCC CAAACGGGAG CGGCCCACCA 781 GCCCTGCCCC CCACAGACCC CCCAAAAGGG TGAAGGCCAA GGCGGTCCCC AGCTGCCCAA 841 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 901 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 961 TATCTTGTGG AAAGGACGAA GGACAACCTC TTTTTGTCCT ATGACGCGTT AAGTCgacaa 1021 tcaacctctg gattacaaaa tttgtgaaag att