Transcript: Human NM_001321059.2

Homo sapiens sirtuin 6 (SIRT6), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
SIRT6 (51548)
Length:
1417
CDS:
25..909

Additional Resources:

NCBI RefSeq record:
NM_001321059.2
NBCI Gene record:
SIRT6 (51548)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321059.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232530 GCTACGTTGACGAGGTCATGA pLKO_005 608 CDS 100% 4.950 6.930 N SIRT6 n/a
2 TRCN0000232531 ACCCGGATCAACGGCTCTATC pLKO_005 754 CDS 100% 3.600 5.040 N SIRT6 n/a
3 TRCN0000368637 CAAGTGTAAGACGCAGTACGT pLKO_005 267 CDS 100% 2.640 3.696 N SIRT6 n/a
4 TRCN0000050476 CACCCGGATCAACGGCTCTAT pLKO.1 753 CDS 100% 1.650 2.310 N SIRT6 n/a
5 TRCN0000378253 CAGTACGTCCGAGACACAGTC pLKO_005 280 CDS 100% 1.350 1.890 N SIRT6 n/a
6 TRCN0000378369 ACGGGAACATGTTTGTGGAAG pLKO_005 239 CDS 100% 4.050 3.240 N SIRT6 n/a
7 TRCN0000232532 CTCCCTGGTCTCCAGCTTAAA pLKO_005 1186 3UTR 100% 13.200 9.240 N SIRT6 n/a
8 TRCN0000232528 GAAGAATGTGCCAAGTGTAAG pLKO_005 256 CDS 100% 10.800 7.560 N SIRT6 n/a
9 TRCN0000050473 TGGAAGAATGTGCCAAGTGTA pLKO.1 254 CDS 100% 4.950 3.465 N SIRT6 n/a
10 TRCN0000232529 TGTCCATCACGCTGGGTACAT pLKO_005 467 CDS 100% 4.950 3.465 N SIRT6 n/a
11 TRCN0000050474 GCAGTCTTCCAGTGTGGTGTT pLKO.1 150 CDS 100% 4.050 2.835 N SIRT6 n/a
12 TRCN0000050477 CACGGGAACATGTTTGTGGAA pLKO.1 238 CDS 100% 2.640 1.848 N SIRT6 n/a
13 TRCN0000050475 GCTGGGTACATCGCTGCAGAT pLKO.1 477 CDS 100% 1.350 0.945 N SIRT6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321059.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03332 pDONR223 100% 82.8% 82.8% None 191_192ins183 n/a
2 ccsbBroad304_03332 pLX_304 0% 82.8% 82.8% V5 191_192ins183 n/a
3 TRCN0000471239 GCAATTGCAGTTCTACACTCACTC pLX_317 44.8% 82.8% 82.8% V5 191_192ins183 n/a
4 ccsbBroadEn_11997 pDONR223 100% 77% 70.9% None (many diffs) n/a
5 ccsbBroad304_11997 pLX_304 0% 77% 70.9% V5 (many diffs) n/a
6 TRCN0000481003 AGGACAACCTCTTTTTGTCCTATG pLX_317 34.1% 77% 70.9% V5 (many diffs) n/a
7 ccsbBroadEn_15849 pDONR223 0% 75.1% 74.9% None 137G>A;191_192ins183;347_427del n/a
8 ccsbBroad304_15849 pLX_304 0% 75.1% 74.9% V5 137G>A;191_192ins183;347_427del n/a
9 TRCN0000473167 AATCTGCCTAGTCGGATTGATCCC pLX_317 44.3% 75% 74.9% V5 (many diffs) n/a
Download CSV