Construct: ORF TRCN0000481055
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003509.2_s317c1
- Derived from:
- ccsbBroadEn_04519
- DNA Barcode:
- ATGCTAACTAGGCTGCTGATGAAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DUOXA1 (90527)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481055
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 90527 | DUOXA1 | dual oxidase maturation fac... | NM_001276264.2 | 100% | 100% | |
| 2 | human | 90527 | DUOXA1 | dual oxidase maturation fac... | NM_144565.4 | 100% | 100% | |
| 3 | human | 90527 | DUOXA1 | dual oxidase maturation fac... | NM_001276265.1 | 90.6% | 90.6% | 204_205ins135 |
| 4 | human | 90527 | DUOXA1 | dual oxidase maturation fac... | NM_001276266.1 | 69.1% | 69.1% | (many diffs) |
| 5 | human | 90527 | DUOXA1 | dual oxidase maturation fac... | XM_006720743.3 | 69.1% | 69.1% | (many diffs) |
| 6 | human | 90527 | DUOXA1 | dual oxidase maturation fac... | XM_006720745.1 | 69.1% | 69.1% | (many diffs) |
| 7 | human | 90527 | DUOXA1 | dual oxidase maturation fac... | XM_006720746.1 | 69.1% | 69.1% | (many diffs) |
| 8 | human | 90527 | DUOXA1 | dual oxidase maturation fac... | XM_006720747.3 | 69.1% | 69.1% | (many diffs) |
| 9 | human | 90527 | DUOXA1 | dual oxidase maturation fac... | XM_006720749.1 | 69.1% | 69.1% | (many diffs) |
| 10 | human | 90527 | DUOXA1 | dual oxidase maturation fac... | XM_006720751.3 | 69.1% | 69.1% | (many diffs) |
| 11 | human | 90527 | DUOXA1 | dual oxidase maturation fac... | XM_011522181.2 | 69.1% | 69.1% | (many diffs) |
| 12 | human | 90527 | DUOXA1 | dual oxidase maturation fac... | XM_011522183.2 | 69.1% | 69.1% | (many diffs) |
| 13 | human | 90527 | DUOXA1 | dual oxidase maturation fac... | XM_006720752.3 | 65.2% | 65.2% | (many diffs) |
| 14 | human | 90527 | DUOXA1 | dual oxidase maturation fac... | NM_001276267.2 | 59.8% | 59.8% | (many diffs) |
| 15 | human | 90527 | DUOXA1 | dual oxidase maturation fac... | NM_001276268.2 | 59.8% | 59.8% | (many diffs) |
| 16 | human | 90527 | DUOXA1 | dual oxidase maturation fac... | XM_006720754.1 | 59.8% | 59.8% | (many diffs) |
| 17 | human | 90527 | DUOXA1 | dual oxidase maturation fac... | XM_006720755.1 | 59.8% | 59.8% | (many diffs) |
| 18 | human | 90527 | DUOXA1 | dual oxidase maturation fac... | XR_931942.1 | 51.3% | 1_146del;1138_2214del;2673_2824del | |
| 19 | human | 90527 | DUOXA1 | dual oxidase maturation fac... | XM_011522184.1 | 45.9% | 41.1% | 553_554ins97;666_667ins686 |
| 20 | human | 90527 | DUOXA1 | dual oxidase maturation fac... | XM_011522185.1 | 44.5% | 38.8% | 553_554ins218;645_646ins586 |
| 21 | human | 90527 | DUOXA1 | dual oxidase maturation fac... | XM_011522186.2 | 38.3% | 38% | 555_556delCA;558_559ins893 |
| 22 | mouse | 213696 | Duoxa1 | dual oxidase maturation fac... | NM_001305262.1 | 58.7% | 57.7% | (many diffs) |
| 23 | mouse | 213696 | Duoxa1 | dual oxidase maturation fac... | XM_006499091.3 | 58.7% | 57.7% | (many diffs) |
| 24 | mouse | 213696 | Duoxa1 | dual oxidase maturation fac... | XM_006499094.3 | 58.7% | 57.7% | (many diffs) |
| 25 | mouse | 213696 | Duoxa1 | dual oxidase maturation fac... | XM_006499095.3 | 58.7% | 57.7% | (many diffs) |
| 26 | mouse | 213696 | Duoxa1 | dual oxidase maturation fac... | XM_017316921.1 | 58.7% | 57.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1515
- ORF length:
- 1449
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc tactttggga cacacattcc ccttctatgc tggccccaag ccaaccttcc 121 cgatggacac cactttggcc agcatcatca tgatctttct gactgcactg gccacgttca 181 tcgtcatcct gcctggcatt cggggaaaga cgaggctgtt ctggctgctt cgggtggtga 241 ccagcttatt catcggggct gcaatcctgg ctgtgaattt cagttctgag tggtctgtgg 301 gccaggtcag caccaacaca tcatacaagg ccttcagttc tgagtggatc agcgctgata 361 ttgggctgca ggtcgggctg ggtggagtca acatcacact cacagggacc cccgtgcagc 421 agctgaatga gaccatcaat tacaacgagg agttcacctg gcgcctgggt gagaactatg 481 ctgaggagta tgcaaaggct ctggagaagg ggctgccaga ccctgtgttg tacctagctg 541 agaagttcac tccaagaagc ccatgtggcc tataccgcca gtaccgcctg gcgggacact 601 acacctcagc catgctatgg gtggcattcc tctgctggct gctggccaat gtgatgctct 661 ccatgcctgt gctggtatat ggtggctaca tgctattggc cacgggcatc ttccagctgt 721 tggctctgct cttcttctcc atggccacat cactcacctc accctgtccc ctgcacctgg 781 gcgcttctgt gctgcatact caccatgggc ctgccttctg gatcacattg accacaggac 841 tgctgtgtgt gctgctgggc ctggctatgg cggtggccca caggatgcag cctcacaggc 901 tgaaggcttt cttcaaccag agtgtggatg aagaccccat gctggagtgg agtcctgagg 961 aaggtggact cctgagcccc cgctaccggt ccatggctga cagtcccaag tcccaggaca 1021 ttcccctgtc agaggcttcc tccaccaagg catactatcg ccccaggaga ctttccctgg 1081 tgcctgcgga tgtccgaggc ctcgcgccag cagcgctcag tgcccttcct ggagctctcc 1141 tggcccaggc ctggcgggca ctgcttcccg gccTGCGATG TCCCAAGGCG GGGAAGGAGT 1201 CCAGATTGGG TCCCCCTCAC AGTCCTTGGC GCTTTGGTCC AGAAGGGTGC GAAGAGCGCT 1261 GGGCCGAACA TACTGGAGAC TCACCACGGC CCCTCCGAGG AAGAGGCACA GGACGCCTGT 1321 GGCGGTGGGG ATCGAAAGAA AGGAGGGCAT GTGGAGTCAG GGCTATGTTG CCCAGGCTGG 1381 TCTCGAACTC TGGCCTCAAA CGACCTTCCT GCCTCGACCT CCCAAAGTGC TGGGATTACA 1441 GGCGTGATGC CCGGGCCTTC TTCCATCTTT TGGAGCCTAC CCCTTGTGTT ACCTCCCGCC 1501 ACACACCTCT AATCTGCCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1561 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1621 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA ATGCTAACTA GGCTGCTGAT 1681 GAACACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt