Transcript: Human XR_931942.1

PREDICTED: Homo sapiens dual oxidase maturation factor 1 (DUOXA1), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DUOXA1 (90527)
Length:
2824
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_931942.1
NBCI Gene record:
DUOXA1 (90527)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_931942.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134520 GCTGAATGAGACCATCAATTA pLKO.1 503 3UTR 100% 13.200 9.240 N DUOXA1 n/a
2 TRCN0000162196 CTGAGAAGTTCACTCCAAGAA pLKO.1 619 3UTR 100% 4.950 3.465 N DUOXA1 n/a
3 TRCN0000160961 GAGAACTATGCTGAGGAGTAT pLKO.1 552 3UTR 100% 4.950 3.465 N DUOXA1 n/a
4 TRCN0000133806 CATCAATTACAACGAGGAGTT pLKO.1 515 3UTR 100% 4.050 2.835 N DUOXA1 n/a
5 TRCN0000164558 CCTTCAGTTCTGAGTGGATCA pLKO.1 412 3UTR 100% 4.050 2.835 N DUOXA1 n/a
6 TRCN0000160795 CCATCAATTACAACGAGGAGT pLKO.1 514 3UTR 100% 2.640 1.848 N DUOXA1 n/a
7 TRCN0000163372 GATCACATTGACCACAGGACT pLKO.1 902 3UTR 100% 2.640 1.848 N DUOXA1 n/a
8 TRCN0000136594 GATCGAAAGAAAGGAGGGCAT pLKO.1 2488 3UTR 100% 2.160 1.512 N DUOXA1 n/a
9 TRCN0000164253 CAGGCTGAAGGCTTTCTTCAA pLKO.1 977 3UTR 100% 0.495 0.347 N DUOXA1 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2579 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2579 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_931942.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04519 pDONR223 100% 51.3% None 1_146del;1138_2214del;2673_2824del n/a
2 ccsbBroad304_04519 pLX_304 0% 51.3% V5 1_146del;1138_2214del;2673_2824del n/a
3 TRCN0000481055 ATGCTAACTAGGCTGCTGATGAAC pLX_317 23.9% 51.3% V5 1_146del;1138_2214del;2673_2824del n/a
Download CSV