Transcript: Mouse XM_006499095.3

PREDICTED: Mus musculus dual oxidase maturation factor 1 (Duoxa1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Duoxa1 (213696)
Length:
1471
CDS:
241..1266

Additional Resources:

NCBI RefSeq record:
XM_006499095.3
NBCI Gene record:
Duoxa1 (213696)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499095.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429070 CCCGCTTTCTGGATCACGTTA pLKO_005 985 CDS 100% 4.950 6.930 N Duoxa1 n/a
2 TRCN0000182163 CAACGCCAACACAACGTACAA pLKO.1 483 CDS 100% 4.950 3.960 N Duoxa1 n/a
3 TRCN0000422360 GTCCGACTGTTCCCTGTAAAG pLKO_005 1248 CDS 100% 10.800 7.560 N Duoxa1 n/a
4 TRCN0000182660 GCACTGGTCACCTTCATCATT pLKO.1 340 CDS 100% 5.625 3.938 N Duoxa1 n/a
5 TRCN0000178487 GCTGAATGAAACCATCAACTA pLKO.1 597 CDS 100% 4.950 3.465 N Duoxa1 n/a
6 TRCN0000198765 CTTTCCAATGGACACTACTCT pLKO.1 291 CDS 100% 3.000 2.100 N Duoxa1 n/a
7 TRCN0000200107 CCAACCTTTCCAATGGACACT pLKO.1 286 CDS 100% 2.640 1.848 N Duoxa1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499095.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04519 pDONR223 100% 58.7% 57.7% None (many diffs) n/a
2 ccsbBroad304_04519 pLX_304 0% 58.7% 57.7% V5 (many diffs) n/a
3 TRCN0000481055 ATGCTAACTAGGCTGCTGATGAAC pLX_317 23.9% 58.7% 57.7% V5 (many diffs) n/a
Download CSV