Construct: ORF TRCN0000481113
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007747.1_s317c1
- Derived from:
- ccsbBroadEn_01961
- DNA Barcode:
- AACCTTCGCATCCTACTTACCTGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PRKRA (8575)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481113
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8575 | PRKRA | protein activator of interf... | NM_003690.5 | 100% | 100% | |
| 2 | human | 8575 | PRKRA | protein activator of interf... | NM_001139517.1 | 94.5% | 93.9% | (many diffs) |
| 3 | human | 8575 | PRKRA | protein activator of interf... | NM_001139518.1 | 92% | 92% | 0_1ins75 |
| 4 | human | 8575 | PRKRA | protein activator of interf... | XM_011512063.2 | 70.7% | 65.9% | (many diffs) |
| 5 | human | 8575 | PRKRA | protein activator of interf... | NM_001316362.2 | 63.8% | 63.8% | 0_1ins339 |
| 6 | human | 8575 | PRKRA | protein activator of interf... | XM_011512066.2 | 63.8% | 63.8% | 0_1ins339 |
| 7 | human | 8575 | PRKRA | protein activator of interf... | XM_017005159.1 | 63.8% | 63.8% | 0_1ins339 |
| 8 | human | 8575 | PRKRA | protein activator of interf... | XR_001739008.2 | 47.9% | 1_136del;650_651ins95;981_1665del | |
| 9 | mouse | 23992 | Prkra | protein kinase, interferon ... | NM_011871.2 | 90.3% | 98% | (many diffs) |
| 10 | mouse | 23992 | Prkra | protein kinase, interferon ... | XM_011239517.2 | 63.6% | 65.9% | (many diffs) |
| 11 | mouse | 23992 | Prkra | protein kinase, interferon ... | XM_011239518.2 | 63.5% | 65.7% | (many diffs) |
| 12 | mouse | 23992 | Prkra | protein kinase, interferon ... | XM_017318023.1 | 56% | 62.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1005
- ORF length:
- 939
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc ccagagcagg caccgcgccg aggccccgcc gctggagcgc gaggacagtg 121 ggaccttcag tttggggaag atgataacag ctaagccagg gaaaacaccg attcaggtat 181 tacacgaata cggcatgaag accaagaaca tcccagttta tgaatgtgaa agatctgatg 241 tgcaaataca cgtgcccact ttcaccttca gagtaaccgt tggtgacata acctgcacag 301 gtgaaggtac aagtaagaag ctggcgaaac atagagctgc agaggctgcc ataaacattt 361 tgaaagccaa tgcaagtatt tgctttgcag ttcctgaccc cttaatgcct gacccttcca 421 agcaaccaaa gaaccagctt aatcctattg gttcattaca ggaattggct attcatcatg 481 gctggagact tcctgaatat accctttccc aggagGGAGG ACCTGCTCAT AAGAGAGAAT 541 ATACTACAAT TTGCAGGCTA GAGTCATTTA TGGAAACTGG AAAGGGGGCA TCAAAAAAGC 601 AAGCCAAAAG GAATGCTGCT GAGAAATTTC TTGCCAAATT TAGTAATATT TCTCCAGAGA 661 ACCACATTTC TTTAACAAAT GTAGTAGGAC ATTCTTTAGG ATGTACTTGG CATTCCTTGA 721 GGAATTCTCC TGGTGAAAAG ATCAACTTAC TGAAAAGAAG CCTCCTTAGT ATTCCAAATA 781 CAGATTACAT CCAGCTGCTT AGTGAAATTG CCAAGGAACA AGGTTTTAAT ATAACATATT 841 TGGATATAGA TGAACTGAGC GCCAATGGAC AATATCAATG TCTTGCTGAA CTGTCCACCA 901 GCCCCATCAC AGTCTGTCAT GGCTCCGGTA TCTCCTGTGG CAATGCACAA AGTGATGCAG 961 CTCACAATGC TTTGCAGTAT TTAAAGATAA TAGCAGAAAG AAAGTACCCA ACTTTCTTGT 1021 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1081 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1141 GAAAGGACGA AACCTTCGCA TCCTACTTAC CTGCACGCGT TAAGTCgaca atcaacctct 1201 ggattacaaa atttgtgaaa gatt