Transcript: Mouse XM_017318023.1

PREDICTED: Mus musculus protein kinase, interferon inducible double stranded RNA dependent activator (Prkra), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prkra (23992)
Length:
1269
CDS:
188..790

Additional Resources:

NCBI RefSeq record:
XM_017318023.1
NBCI Gene record:
Prkra (23992)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318023.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024834 GCAAGGCTTTAACATAACGTA pLKO.1 601 CDS 100% 3.000 2.400 N Prkra n/a
2 TRCN0000024836 GCTGGCGACTTCCTGAATATA pLKO.1 264 CDS 100% 15.000 10.500 N Prkra n/a
3 TRCN0000024837 GCAAGTATTTGCTTTGCAGTT pLKO.1 155 5UTR 100% 4.050 2.835 N Prkra n/a
4 TRCN0000024838 CCAGAGAACCACATTTCTCTA pLKO.1 437 CDS 100% 0.495 0.347 N Prkra n/a
5 TRCN0000195388 CAAGTAAGAAGCTGGCGAAAC pLKO.1 93 5UTR 100% 6.000 4.200 N PRKRA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318023.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01961 pDONR223 100% 56% 62.9% None (many diffs) n/a
2 ccsbBroad304_01961 pLX_304 0% 56% 62.9% V5 (many diffs) n/a
3 TRCN0000481113 AACCTTCGCATCCTACTTACCTGC pLX_317 52.1% 56% 62.9% V5 (many diffs) n/a
4 TRCN0000489830 GACAGTGACTAATAAATACGGATT pLX_317 40.3% 56% 62.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV