Transcript: Human XM_011512063.2

PREDICTED: Homo sapiens protein activator of interferon induced protein kinase EIF2AK2 (PRKRA), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRKRA (8575)
Length:
1801
CDS:
432..1118

Additional Resources:

NCBI RefSeq record:
XM_011512063.2
NBCI Gene record:
PRKRA (8575)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512063.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194656 CTCCTCATAGTTGTTATTAAG pLKO.1 1261 3UTR 100% 13.200 18.480 N PRKRA n/a
2 TRCN0000196934 GAGTAACCGTTGGTGACATAA pLKO.1 333 5UTR 100% 13.200 18.480 N PRKRA n/a
3 TRCN0000052644 GCGCCAATGGACAATATCAAT pLKO.1 970 CDS 100% 5.625 7.875 N PRKRA n/a
4 TRCN0000196895 GCTAGAGTCATTTATGGAAAC pLKO.1 668 CDS 100% 6.000 4.800 N PRKRA n/a
5 TRCN0000052645 CGATTCAGGTATTACACGAAT pLKO.1 231 5UTR 100% 4.950 3.960 N PRKRA n/a
6 TRCN0000195535 CAGCACTAACAGGCCTTTATT pLKO.1 1525 3UTR 100% 15.000 10.500 N PRKRA n/a
7 TRCN0000052647 CCTGCTCATAAGAGAGAATAT pLKO.1 633 CDS 100% 13.200 9.240 N PRKRA n/a
8 TRCN0000052646 GCCTCCTTAGTATTCCAAATA pLKO.1 871 CDS 100% 13.200 9.240 N PRKRA n/a
9 TRCN0000195550 CAAATACACGTGCCCACTTTC pLKO.1 305 5UTR 100% 10.800 7.560 N PRKRA n/a
10 TRCN0000052643 GCAACCAAAGAACCAGCTTAA pLKO.1 533 CDS 100% 10.800 7.560 N PRKRA n/a
11 TRCN0000174216 GCAACCAAAGAACCAGCTTAA pLKO.1 533 CDS 100% 10.800 7.560 N PRKRA n/a
12 TRCN0000196605 GTAGTGTTTATGTCTTGTTTC pLKO.1 1197 3UTR 100% 10.800 7.560 N PRKRA n/a
13 TRCN0000195388 CAAGTAAGAAGCTGGCGAAAC pLKO.1 372 5UTR 100% 6.000 4.200 N PRKRA n/a
14 TRCN0000199545 CCTGTGGCAATGCACAAAGTG pLKO.1 1045 CDS 100% 4.950 3.465 N PRKRA n/a
15 TRCN0000024835 CGGCATGAAGACCAAGAACAT pLKO.1 253 5UTR 100% 4.950 3.465 N Prkra n/a
16 TRCN0000196873 GCATGTTTGTTGTTGATGATG pLKO.1 1394 3UTR 100% 4.950 3.465 N PRKRA n/a
17 TRCN0000194714 CCCTTTAGAATTAGAGTCTTG pLKO.1 1499 3UTR 100% 4.050 2.835 N PRKRA n/a
18 TRCN0000196476 GCTGAGAAATTTCTTGCCAAA pLKO.1 729 CDS 100% 4.050 2.835 N PRKRA n/a
19 TRCN0000195728 CAAATGTAGTAGGACATTCTT pLKO.1 787 CDS 100% 0.563 0.394 N PRKRA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512063.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01961 pDONR223 100% 70.7% 65.9% None (many diffs) n/a
2 ccsbBroad304_01961 pLX_304 0% 70.7% 65.9% V5 (many diffs) n/a
3 TRCN0000481113 AACCTTCGCATCCTACTTACCTGC pLX_317 52.1% 70.7% 65.9% V5 (many diffs) n/a
4 TRCN0000489830 GACAGTGACTAATAAATACGGATT pLX_317 40.3% 70.7% 65.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV