Construct: ORF TRCN0000481174
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006944.1_s317c1
- Derived from:
- ccsbBroadEn_12175
- DNA Barcode:
- ATCGTGTCTAGATCAAACACAAGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- INTS10 (55174)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481174
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 55174 | INTS10 | integrator complex subunit 10 | NM_001353515.1 | 100% | 100% | |
2 | human | 55174 | INTS10 | integrator complex subunit 10 | NM_001353514.1 | 95.8% | 95.8% | 1638_1715del |
3 | human | 55174 | INTS10 | integrator complex subunit 10 | NM_001353513.1 | 95.6% | 95.6% | 801_803delGCA;1641_1718del |
4 | human | 55174 | INTS10 | integrator complex subunit 10 | NM_001353512.1 | 89.7% | 89.7% | 1_204del |
5 | human | 55174 | INTS10 | integrator complex subunit 10 | NM_001353511.1 | 86.3% | 86.3% | 1_204del;1842_1919del |
6 | human | 55174 | INTS10 | integrator complex subunit 10 | NM_018142.4 | 84% | 84% | 1_339del |
7 | human | 55174 | INTS10 | integrator complex subunit 10 | NM_001353510.1 | 83.9% | 83.9% | 1_339del;1140_1142delGCA |
8 | human | 55174 | INTS10 | integrator complex subunit 10 | NM_001353506.1 | 81.1% | 81.1% | 1_339del;1977_2054del |
9 | human | 55174 | INTS10 | integrator complex subunit 10 | NM_001353505.1 | 81% | 81% | 1_339del;1140_1142delGCA;1980_2057del |
10 | human | 55174 | INTS10 | integrator complex subunit 10 | NM_001353508.1 | 80.9% | 80.9% | 1_339del;835_836insGAA;1974_2051del |
11 | human | 55174 | INTS10 | integrator complex subunit 10 | NM_001353507.1 | 80.8% | 80.8% | (many diffs) |
12 | human | 55174 | INTS10 | integrator complex subunit 10 | NM_001353521.1 | 80.5% | 80.5% | 0_1ins348 |
13 | human | 55174 | INTS10 | integrator complex subunit 10 | NM_001353522.1 | 80.5% | 80.5% | 0_1ins348 |
14 | human | 55174 | INTS10 | integrator complex subunit 10 | XM_017013606.2 | 78.4% | 77.4% | (many diffs) |
15 | human | 55174 | INTS10 | integrator complex subunit 10 | NM_001353509.1 | 78.2% | 78.2% | 1_339del;772_773ins63;1914_1991del |
16 | human | 55174 | INTS10 | integrator complex subunit 10 | NM_001353517.1 | 77.2% | 77.2% | 0_1ins348;1290_1367del |
17 | human | 55174 | INTS10 | integrator complex subunit 10 | NM_001353518.1 | 77.2% | 77.2% | 0_1ins348;1290_1367del |
18 | human | 55174 | INTS10 | integrator complex subunit 10 | NM_001353519.1 | 77.2% | 77.2% | 0_1ins348;1290_1367del |
19 | human | 55174 | INTS10 | integrator complex subunit 10 | NM_001353516.1 | 77% | 77% | 0_1ins348;453_455delGCA;1293_1370del |
20 | human | 55174 | INTS10 | integrator complex subunit 10 | XM_017013607.1 | 74.4% | 72.9% | (many diffs) |
21 | human | 55174 | INTS10 | integrator complex subunit 10 | NM_001353520.1 | 73.8% | 73.8% | 0_1ins348;85_86ins63;1227_1304del |
22 | human | 55174 | INTS10 | integrator complex subunit 10 | XR_001745551.2 | 70.2% | (many diffs) | |
23 | human | 55174 | INTS10 | integrator complex subunit 10 | XR_001745552.2 | 67.9% | (many diffs) | |
24 | human | 55174 | INTS10 | integrator complex subunit 10 | XR_002956637.1 | 67.4% | 1_486del;2124_2241del;2396_2654del | |
25 | human | 55174 | INTS10 | integrator complex subunit 10 | XR_001745550.2 | 66.9% | (many diffs) | |
26 | human | 55174 | INTS10 | integrator complex subunit 10 | NR_148456.1 | 61.1% | 1_728del;2029_2157del;2649_2929del | |
27 | human | 55174 | INTS10 | integrator complex subunit 10 | NR_148454.1 | 60.6% | (many diffs) | |
28 | human | 55174 | INTS10 | integrator complex subunit 10 | NR_148453.1 | 59.6% | (many diffs) | |
29 | human | 55174 | INTS10 | integrator complex subunit 10 | NR_148458.1 | 59.3% | 1_728del;2366_2585del;2740_3020del | |
30 | human | 55174 | INTS10 | integrator complex subunit 10 | NR_148455.1 | 57.8% | 1_728del;1224_1225ins170;2350_2630del | |
31 | human | 55174 | INTS10 | integrator complex subunit 10 | NR_148451.1 | 57.1% | (many diffs) | |
32 | human | 55174 | INTS10 | integrator complex subunit 10 | NR_148452.1 | 53.8% | (many diffs) | |
33 | human | 55174 | INTS10 | integrator complex subunit 10 | NR_148457.1 | 53.6% | (many diffs) | |
34 | mouse | 70885 | Ints10 | integrator complex subunit 10 | NM_027590.4 | 73.2% | 79.8% | (many diffs) |
35 | mouse | 70885 | Ints10 | integrator complex subunit 10 | XM_006509747.3 | 73.1% | 79.7% | (many diffs) |
36 | mouse | 70885 | Ints10 | integrator complex subunit 10 | NM_001293792.1 | 70.6% | 77% | (many diffs) |
37 | mouse | 70885 | Ints10 | integrator complex subunit 10 | NM_001293791.1 | 70.6% | 76.9% | (many diffs) |
38 | mouse | 70885 | Ints10 | integrator complex subunit 10 | XM_006509743.3 | 70.5% | 76.9% | (many diffs) |
39 | mouse | 70885 | Ints10 | integrator complex subunit 10 | XM_006509744.3 | 70.5% | 76.7% | (many diffs) |
40 | mouse | 70885 | Ints10 | integrator complex subunit 10 | XM_006509742.3 | 68.2% | 74.2% | (many diffs) |
41 | mouse | 70885 | Ints10 | integrator complex subunit 10 | XM_006509741.2 | 68.1% | 74.1% | (many diffs) |
42 | mouse | 70885 | Ints10 | integrator complex subunit 10 | XM_011242326.1 | 54.1% | 57.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1857
- ORF length:
- 1791
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt actaaaggtc acggaacaat gcttcaacac gttagaacga tcagaaatgt 121 tgcttctact tttgaggcgc ttccctgaaa cggtggtgca gcatggggtt ggccttgggg 181 aggcactatt agaggctgaa actattgaag aacaagaatc tccagtgaac tgctttagaa 241 aattatttgt ttgtgatgtc cttcctctaa taattaacaa ccatgatgtt cgattacctg 301 ccaatttatt gtataagtac ttgaacaaag cagctgaatt ttatatcaat tatgtcacta 361 ggtctactca aatagaaaat cagcatcaag gcgcccagga tacatctgat ttaatgtcac 421 ctagcaaacg tagctctcag aagtacataa tagaagggct gacggaaaaa tcatcccaga 481 tcgtggaccc ttgggagagg ttgtttaaga ttttgaatgt tgttggaatg agatgtgaat 541 ggcagatgga taaaggaaga cgaagctatg gagatatttt gcatagaatg aaggatctct 601 gcagatacat gaacaacttt gatagtgaag cacatgcaaa atataaaaac caagtggtgt 661 attccaccat gctggtcttc tttaagaatg cattccagta tgtcaacagc atacagccat 721 ctctcttcca aggtcctaat gccccgagcc aagttccact ggttcttctt gaagatgtat 781 cgaatgtgta tggtgatgta gaaattgatc gtaataaaca catccataaa aagaggaaac 841 tagctgaagg aagagaaaaa accatgagtt cagacgatga agactgttcg gcgaaaggaa 901 gaaatcgtca cattgtagtc aataaagccg aacttgctaa ctccactgaa gtgttagaaa 961 gctttaaatt ggccagggag agctgggagt tgctctattc cctagaattc cttgacaaag 1021 aatttacaag gatttgcttg gcctggaaga cggatacttg gctttggtta agaatcttcc 1081 tcactgatat gatcatctat cagggtcaat ataaaaaggc gatagccagc ctgcatcact 1141 tagcagctct ccagggatcc atttctcagc cacagatcac agggcagggg accctggagc 1201 atcagagggc gctcatccag ctggcgacgt gccactttgc gctaggggag tacagaatga 1261 catgtgaaaa agtccttgat ttgatgtgct acatggtact ccccattcaa gatggaggca 1321 aatcccagga ggaaccctcg aaagtaaagc ccaaatttag aaaaggttcg gaTCTGAAGC 1381 TCCTGCCTTG TACCAGCAAG GCTATCATGC CATACTGCCT CCATTTAATG TTAGCCTGTT 1441 TTAAGCTTAG AGCTTTCACA GACAACAGAG ACGACATGGC ATTGGGGCAT GTGATTGTGT 1501 TGCTTCAGCA AGAGTGGCCA CGGGGCGAGA ATCTTTTCCT GAAAGCTGTC AATAAAATTT 1561 GCCAACAAGG AAATTTCCAA TATGAGAATT TTTTCAATTA CGTTACAAAT ATTGATATGC 1621 TGGAGGAATT TGCCTACTTG AGAACTCAGG AAGGTGGGAA AATTCATCTG GAATTACTAC 1681 CCAATCAAGG AATGCTGATC AAGCACCACA CTGTAACTCG AGGCATCACC AAAGGCGTGA 1741 AGGAGGACTT TCGCCTGGCC ATGGAGCGCC AGGTCTCCCG CTGTGGAGAG AATCTGATGG 1801 TGGTTCTGCA CAGGTTCTGC ATTAATGAGA AGATCTTGCT CCTTCAGACT CTGACCTGCC 1861 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1921 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1981 ATATATCTTG TGGAAAGGAC GAATCGTGTC TAGATCAAAC ACAAGAACGC GTTAAGTCga 2041 caatcaacct ctggattaca aaatttgtga aagatt