Transcript: Human XR_002956637.1

PREDICTED: Homo sapiens integrator complex subunit 10 (INTS10), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
INTS10 (55174)
Length:
2654
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002956637.1
NBCI Gene record:
INTS10 (55174)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002956637.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128135 CGTTAGAACGATCAGAAATGT pLKO.1 521 3UTR 100% 5.625 7.875 N INTS10 n/a
2 TRCN0000127978 GCACTATTAGAGGCTGAAACT pLKO.1 604 3UTR 100% 4.950 6.930 N INTS10 n/a
3 TRCN0000129396 GATGAAGACTGTTCGGCGAAA pLKO.1 1297 3UTR 100% 4.050 5.670 N INTS10 n/a
4 TRCN0000130762 GATGTTCGATTACCTGCCAAT pLKO.1 706 3UTR 100% 4.050 5.670 N INTS10 n/a
5 TRCN0000127515 CGTAGCTCTCAGAAGTACATA pLKO.1 850 3UTR 100% 5.625 3.938 N INTS10 n/a
6 TRCN0000129437 GAGAAGACACTCAGCAGTGAT pLKO.1 2445 3UTR 100% 4.950 3.465 N INTS10 n/a
7 TRCN0000131143 GTTCTGCACAGGTTCTGCATT pLKO.1 2342 3UTR 100% 4.950 3.465 N INTS10 n/a
8 TRCN0000128053 GCCTGTGTAATTGTAGGAGAA pLKO.1 2429 3UTR 100% 4.050 2.835 N INTS10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002956637.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12175 pDONR223 100% 67.4% None 1_486del;2124_2241del;2396_2654del n/a
2 ccsbBroad304_12175 pLX_304 0% 67.4% V5 1_486del;2124_2241del;2396_2654del n/a
3 TRCN0000481174 ATCGTGTCTAGATCAAACACAAGA pLX_317 27.3% 67.4% V5 1_486del;2124_2241del;2396_2654del n/a
Download CSV