Construct: ORF TRCN0000481201
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008784.1_s317c1
- Derived from:
- ccsbBroadEn_07766
- DNA Barcode:
- TAGCGAAGTCCGGTATTGCCACGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RASSF1 (11186)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481201
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 11186 | RASSF1 | Ras association domain fami... | NM_007182.5 | 99.9% | 99.7% | 397G>T |
| 2 | human | 11186 | RASSF1 | Ras association domain fami... | NM_170714.2 | 98.7% | 98.2% | 251_262del;409G>T |
| 3 | human | 11186 | RASSF1 | Ras association domain fami... | NM_170713.3 | 72.1% | 64.9% | (many diffs) |
| 4 | human | 11186 | RASSF1 | Ras association domain fami... | XM_024453328.1 | 72.1% | 64.9% | (many diffs) |
| 5 | human | 11186 | RASSF1 | Ras association domain fami... | NM_001206957.1 | 55.5% | 55.5% | 0_1ins453 |
| 6 | human | 11186 | RASSF1 | Ras association domain fami... | NM_170712.3 | 55.5% | 55.5% | 0_1ins453 |
| 7 | human | 11186 | RASSF1 | Ras association domain fami... | XM_011533316.2 | 55.5% | 55.5% | 0_1ins453 |
| 8 | mouse | 56289 | Rassf1 | Ras association (RalGDS/AF-... | NM_001243748.1 | 85.3% | 90.8% | (many diffs) |
| 9 | mouse | 56289 | Rassf1 | Ras association (RalGDS/AF-... | NM_019713.4 | 63.6% | 55% | (many diffs) |
| 10 | mouse | 56289 | Rassf1 | Ras association (RalGDS/AF-... | XM_006511770.2 | 47.3% | 52.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1089
- ORF length:
- 1020
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtcgggggag cctgagctca ttgagctgcg ggagctggca cccgctgggc 121 gcgctgggaa gggccgcacc cggctggagc gtgccaacgc gctgcgcatc gcgcggggca 181 ccgcgtgcaa ccccacacgg cagctggtcc ctggccgtgg ccaccgcttc cagcccgcgg 241 ggcccgccac gcacacgtgg tgcgacctct gtggcgactt catctggggc gtcgtgcgca 301 aaggcctgca gtgcgcgcat tgcaagttca cctgccacta ccgctgccgc gcgctcgtct 361 gcctggactg ttgcgggccc cgggacctgg gctgggaacc cgcggtggag cgggacacga 421 acgtggacga gcctgtggag tgggagacac ctgacctttc tcaatctgag attgagcaga 481 agatcaagga gtacaatgcc cagatcaaca gcaacctctt catgagcttg aacaaggacg 541 gttcttacac aggcttcatc aaggttcagc tgaagctggt gcgccctgtc tctgtgcccT 601 CCAGCAAGAA GCCACCCTCC TTGCAGGATG CCCGGCGGGG CCCAGGACGG GGCACAAGTG 661 TCAGGCGCCG CACTTCCTTT TACCTGCCCA AGGATGCTGT CAAGCACCTG CATGTGCTGT 721 CACGCACAAG GGCACGTGAA GTCATTGAGG CCCTGCTGCG AAAGTTCTTG GTGGTGGATG 781 ACCCCCGCAA GTTTGCACTC TTTGAGCGCG CTGAGCGTCA CGGCCAAGTG TACTTGCGGA 841 AGCTGTTGGA TGATGAGCAG CCCCTGCGGC TGCGGCTCCT GGCAGGGCCC AGTGACAAGG 901 CCCTGAGCTT TGTCCTGAAG GAAAATGACT CTGGGGAGGT GAACTGGGAC GCCTTCAGCA 961 TGCCTGAACT ACATAACTTC CTACGTATCC TGCAGCGGGA GGAGGAGGAG CACCTCCGCC 1021 AGATCCTGCA GAAGTACTCC TATTGCCGCC AGAAGATCCA AGAGGCCCTG CACGCCTGCC 1081 CCCTTGGGTT GCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1141 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1201 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGATAGCGA AGTCCGGTAT TGCCACGCAC 1261 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt