Construct: ORF TRCN0000481208
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006862.1_s317c1
- Derived from:
- ccsbBroadEn_01944
- DNA Barcode:
- TCCGTGTCTCGACTTCAGTGAGCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MMP23B (8510)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481208
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8510 | MMP23B | matrix metallopeptidase 23B | NM_006983.2 | 100% | 100% | |
| 2 | human | 8510 | MMP23B | matrix metallopeptidase 23B | XM_017002615.1 | 74.1% | 74.1% | 155_562del |
| 3 | human | 8511 | MMP23A | matrix metallopeptidase 23A... | NR_002946.1 | 73% | 1_1delAins154;132_133ins140;878_906del | |
| 4 | human | 8510 | MMP23B | matrix metallopeptidase 23B | XM_017002617.1 | 63.1% | 63.1% | 155_562del;1404_1405ins174 |
| 5 | human | 8510 | MMP23B | matrix metallopeptidase 23B | XR_002957848.1 | 42.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1236
- ORF length:
- 1170
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg ccgcggggcc cgtgtcccct cggaggcccc gggggcaggc gtcgagcgcc 121 gctggcttgg agccgcgctg gtcgccctgt gcctcctccc cgcgctggtg ctgctggccc 181 ggctgggggc cccggcggtg ccggcctgga gcgcagcgca gggagacgtc gctgcgctgg 241 gcctctcggc ggtccccccc acccgggtcc cgggcccact ggccccccgc agacgccgct 301 acacgctgac tccagccagg ctgcgctggg accacttcaa cctcacctac aggatcctct 361 ccttcccgcg gaacctgctg agcccgcggg agacgcggcg ggccctagct gccgccttcc 421 gcatgtggag cgacgtgtcc cccttcagct tccgcgaggt ggcccccgag cagcccagcg 481 acctccggat aggcttctac ccgatcaacc acacggactg cctggtctcc gcgctgcacc 541 actgcttcga cggccccacg ggggagctgg cccacgcctt cttccccccg cacggcggca 601 tccacttcga cgacagcgag tactgggtcc tgggccccac gcgctacagc tggaagaaag 661 gcgtgtggct cacggacctg gtgcacgtgg cggcccacga gatcggccac gcgctgggcc 721 tgatgcactc acaacacggc cgggcgctca tgcacctgaa cgccacgctg cgcggctgga 781 aggcgttgtc ccaggacgag ctgtgggggc tgcaccggct cTACGGATGC CTCGACAGGC 841 TGTTCGTGTG CGCGTCCTGG GCGCGGAGGG GCTTCTGCGA CGCTCGCCGG CGGCTCATGA 901 AGAGGCTCTG CCCCAGCAGC TGCGACTTCT GCTACGAATT CCCCTTCCCC ACGGTGGCCA 961 CCACCCCACC GCCCCCCAGG ACCAAAACCA GGCTGGTGCC CGAGGGCAGG AACGTGACCT 1021 TCCGCTGCGG CCAGAAGATC CTCCACAAGA AAGGGAAAGT GTACTGGTAC AAGGACCAGG 1081 AGCCCCTGGA GTTCTCCTAC CCCGGCTACC TGGCCCTGGG CGAGGCGCAC CTGAGCATCA 1141 TCGCCAACGC CGTCAATGAG GGCACCTACA CCTGCGTGGT GCGCCGCCAG CAGCGCGTGC 1201 TGACCACCTA CTCCTGGCGA GTCCGTGTGC GGGGCTGCCC AACTTTCTTG TACAAAGTGG 1261 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1321 CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA TCCGTGTCTC 1381 GACTTCAGTG AGCGACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa 1441 gatt