Transcript: Human XM_017002617.1

PREDICTED: Homo sapiens matrix metallopeptidase 23B (MMP23B), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MMP23B (8510)
Length:
2039
CDS:
539..1945

Additional Resources:

NCBI RefSeq record:
XM_017002617.1
NBCI Gene record:
MMP23B (8510)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002617.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052199 GATAGGCTTCTACCCGATCAA pLKO.1 1369 CDS 100% 4.950 3.465 N MMP23B n/a
2 TRCN0000052201 CACCTACAGGATCCTCTCCTT pLKO.1 1225 CDS 100% 2.640 1.848 N MMP23B n/a
3 TRCN0000417522 AGAAGATCCTCCACAAGAAAG pLKO_005 1914 CDS 100% 10.800 5.400 Y MMP23B n/a
4 TRCN0000052203 CCACAAGAAAGGGAAAGTGTA pLKO.1 1924 CDS 100% 4.950 2.475 Y MMP23A n/a
5 TRCN0000052204 CCAGAAGATCCTCCACAAGAA pLKO.1 1912 CDS 100% 4.950 2.475 Y MMP23A n/a
6 TRCN0000439835 CCACTTCAACCTCACCTACAG pLKO_005 1213 CDS 100% 4.050 2.025 Y MMP23B n/a
7 TRCN0000052207 CTGGGCCTGATGCACTCACAA pLKO.1 1595 CDS 100% 1.650 0.825 Y MMP23A n/a
8 TRCN0000052202 CCACTTCGACGACAGCGAGTA pLKO.1 1483 CDS 100% 1.350 0.675 Y MMP23B n/a
9 TRCN0000052206 GCACCTGAGCATCATCGCCAA pLKO.1 2012 3UTR 100% 0.720 0.360 Y MMP23A n/a
10 TRCN0000052198 CTGCGACTTCTGCTACGAATT pLKO.1 1801 CDS 100% 0.000 0.000 Y MMP23B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002617.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01944 pDONR223 100% 63.1% 63.1% None 155_562del;1404_1405ins174 n/a
2 ccsbBroad304_01944 pLX_304 0% 63.1% 63.1% V5 155_562del;1404_1405ins174 n/a
3 TRCN0000481208 TCCGTGTCTCGACTTCAGTGAGCG pLX_317 35.7% 63.1% 63.1% V5 155_562del;1404_1405ins174 n/a
Download CSV