Construct: ORF TRCN0000481302
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012864.4_s317c1
- Derived from:
- ccsbBroadEn_14577
- DNA Barcode:
- CGGTCTGAGCGTTCTGAGTTTCTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CDK7 (1022)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481302
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1022 | CDK7 | cyclin dependent kinase 7 | NM_001799.4 | 100% | 100% | |
| 2 | human | 1022 | CDK7 | cyclin dependent kinase 7 | NM_001324069.2 | 87.9% | 87.8% | 0_1ins123;2_3delTGinsAA |
| 3 | human | 1022 | CDK7 | cyclin dependent kinase 7 | NM_001324070.2 | 83.5% | 83.5% | 126_127ins171 |
| 4 | human | 1022 | CDK7 | cyclin dependent kinase 7 | NM_001324071.2 | 83.5% | 74% | 0_1ins34;125_126ins137 |
| 5 | human | 1022 | CDK7 | cyclin dependent kinase 7 | NM_001324072.1 | 73.1% | 73.1% | 0_1ins279 |
| 6 | human | 1022 | CDK7 | cyclin dependent kinase 7 | NM_001324074.2 | 73.1% | 73.1% | 0_1ins279 |
| 7 | human | 1022 | CDK7 | cyclin dependent kinase 7 | NM_001324075.2 | 73.1% | 73.1% | 0_1ins279 |
| 8 | human | 1022 | CDK7 | cyclin dependent kinase 7 | NM_001324077.1 | 73.1% | 73.1% | 0_1ins279 |
| 9 | human | 1022 | CDK7 | cyclin dependent kinase 7 | NM_001324078.2 | 73.1% | 73.1% | 0_1ins279 |
| 10 | human | 1022 | CDK7 | cyclin dependent kinase 7 | XM_011543094.2 | 66.1% | 66.1% | 0_1ins351 |
| 11 | human | 1022 | CDK7 | cyclin dependent kinase 7 | NR_136690.2 | 64.4% | 1_90del;497_498ins119;1010_1307del | |
| 12 | mouse | 12572 | Cdk7 | cyclin-dependent kinase 7 | NM_009874.3 | 87.6% | 95% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1104
- ORF length:
- 1038
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc tctggacgtg aagtctcggg caaagcgtta tgagaagctg gacttccttg 121 gggagggaca gtttgccacc gtttacaagg ccagagataa gaacaccaac caaattgtcg 181 ccattaagaa aatcaaactt ggacatagat cagaagctaa agatggtata aatagaaccg 241 ccttaagaga gataaaatta ttacaggagc taagtcatcc aaatataatt ggtctccttg 301 atgcttttgg acataaatct aatattagcc ttgtctttga ttttatggaa actgatctag 361 aggttataat aaaggataat agtcttgtgc tgacaccatc acacatcaaa gcctacatgt 421 tgatgactct tcaaggatta gaatatttac atcaacattg gatcctacat agggatctga 481 aaccaaacaa cttgttgcta gatgaaaatg gagttctaaa actggcagat tttggcctgg 541 ccaaatcttt tgggagcccc aatagagctt atacacatca ggttgtaacc aggtggtatc 601 gggcccccga gttactattt ggagctagga tgtatggtgt aggtgtggac atgtgggctg 661 ttggctgtat attagcagag ttacttctaa gggTTCCTTT TTTGCCAGGA GATTCAGACC 721 TTGATCAGCT AACAAGAATA TTTGAAACTT TGGGCACACC AACTGAGGAA CAGTGGCCGG 781 ACATGTGTAG TCTTCCAGAT TATGTGACAT TTAAGAGTTT CCCTGGAATA CCTTTGCATC 841 ACATCTTCAG TGCAGCAGGA GACGACTTAC TAGATCTCAT ACAAGGCTTA TTCTTATTTA 901 ATCCATGTGC TCGAATTACG GCCACACAGG CACTGAAAAT GAAGTATTTC AGTAATCGGC 961 CAGGGCCAAC ACCTGGATGT CAGCTGCCAA GACCAAACTG TCCAGTGGAA ACCTTAAAGG 1021 AGCAATCAAA TCCAGCTTTG GCAATAAAAA GGAAAAGAAC AGAGGCCTTA GAACAAGGAG 1081 GATTGCCCAA GAAACTAATT TTTTACCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1141 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1201 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAC GGTCTGAGCG 1261 TTCTGAGTTT CTAACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1321 att