Transcript: Human NM_001324077.1

Homo sapiens cyclin dependent kinase 7 (CDK7), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
CDK7 (1022)
Length:
1400
CDS:
327..1088

Additional Resources:

NCBI RefSeq record:
NM_001324077.1
NBCI Gene record:
CDK7 (1022)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147450 AGCTCCAAATAGTAACTCGG pXPR_003 GGG 265 35% 8 0.6157 CDK7 CDK7 76080
2 BRDN0001162216 TTAAAAACCTTACCCTATGT pXPR_003 AGG 125 16% 6 -0.1172 CDK7 CDK7 76077
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324077.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230909 GAAGCTAAAGATGGTATAAAT pLKO_005 195 5UTR 100% 15.000 21.000 N CDK7 n/a
2 TRCN0000219663 CAACCAAATTGTCGCCATTAA pLKO.1 149 5UTR 100% 13.200 18.480 N CDK7 n/a
3 TRCN0000230908 CAACCAAATTGTCGCCATTAA pLKO_005 149 5UTR 100% 13.200 18.480 N CDK7 n/a
4 TRCN0000218391 TAATCCATGTGCTCGAATTAC pLKO_005 881 CDS 100% 13.200 18.480 N CDK7 n/a
5 TRCN0000219664 TAATCCATGTGCTCGAATTAC pLKO.1 881 CDS 100% 13.200 18.480 N CDK7 n/a
6 TRCN0000000594 TCAGAAGCTAAAGATGGTATA pLKO.1 192 5UTR 100% 10.800 15.120 N CDK7 n/a
7 TRCN0000000593 GCAGGAGACGACTTACTAGAT pLKO.1 837 CDS 100% 4.950 6.930 N CDK7 n/a
8 TRCN0000000595 GTGGGCTGTTGGCTGTATATT pLKO.1 635 CDS 100% 15.000 10.500 N CDK7 n/a
9 TRCN0000218042 AGAGAACACTGGACAACATTT pLKO_005 1089 CDS 100% 13.200 9.240 N CDK7 n/a
10 TRCN0000196306 GAAACTGATCTAGAGGTTATA pLKO.1 330 CDS 100% 13.200 9.240 N CDK7 n/a
11 TRCN0000230910 GAAACTGATCTAGAGGTTATA pLKO_005 330 CDS 100% 13.200 9.240 N CDK7 n/a
12 TRCN0000000592 GCTGTAGAAGTGAGTTTGTAA pLKO.1 1171 3UTR 100% 5.625 3.938 N CDK7 n/a
13 TRCN0000197042 GCCTACATGTTGATGACTCTT pLKO.1 393 CDS 100% 4.950 3.465 N CDK7 n/a
14 TRCN0000000596 CATTTAAGAGTTTCCCTGGAA pLKO.1 790 CDS 100% 2.640 1.848 N CDK7 n/a
15 TRCN0000196691 GTAAATGCTGTAGAAGTGAGT pLKO.1 1165 3UTR 100% 2.640 1.848 N CDK7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324077.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00280 pDONR223 100% 73.1% 73.1% None 0_1ins279 n/a
2 ccsbBroad304_00280 pLX_304 0% 73.1% 73.1% V5 0_1ins279 n/a
3 TRCN0000470052 TGCGACTAGACTGATGGCACGATT pLX_317 46.6% 73.1% 73.1% V5 0_1ins279 n/a
4 ccsbBroadEn_14577 pDONR223 0% 73.1% 73.1% None 0_1ins279 n/a
5 ccsbBroad304_14577 pLX_304 0% 73.1% 73.1% V5 0_1ins279 n/a
6 TRCN0000481302 CGGTCTGAGCGTTCTGAGTTTCTA pLX_317 39.7% 73.1% 73.1% V5 0_1ins279 n/a
7 TRCN0000488377 TACTCTATAAACCTTGCAATCCGC pLX_317 26.5% 73.1% 73.1% V5 (not translated due to prior stop codon) 0_1ins279 n/a
8 ccsbBroadEn_15380 pDONR223 0% 73% 72.8% None 0_1ins279;110A>G n/a
9 ccsbBroad304_15380 pLX_304 0% 73% 72.8% V5 0_1ins279;110A>G n/a
10 TRCN0000475074 AGAAGCTGTACGCAAACCTCGGCC pLX_317 53.1% 73% 72.8% V5 0_1ins279;110A>G n/a
Download CSV