Transcript: Mouse NM_009874.3

Mus musculus cyclin-dependent kinase 7 (Cdk7), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Cdk7 (12572)
Length:
7612
CDS:
104..1144

Additional Resources:

NCBI RefSeq record:
NM_009874.3
NBCI Gene record:
Cdk7 (12572)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146106 TTTCCATAAAATCAAAGACA pXPR_003 AGG 269 26% 5 -0.5712 Cdk7 CDK7 76078
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009874.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321773 CTGTCCGGTGGAGGCATTAAA pLKO_005 1036 CDS 100% 15.000 21.000 N Cdk7 n/a
2 TRCN0000321771 AGGATAACTGCAGTCTCTAAA pLKO_005 1337 3UTR 100% 13.200 18.480 N Cdk7 n/a
3 TRCN0000321772 ATGTGTAGTCTTCCCGATTAT pLKO_005 821 CDS 100% 13.200 18.480 N Cdk7 n/a
4 TRCN0000023088 CTTCCCGATTATGTGACATTT pLKO.1 830 CDS 100% 13.200 18.480 N Cdk7 n/a
5 TRCN0000023085 CCAACCAAATCGTCGCCATTA pLKO.1 204 CDS 100% 10.800 15.120 N Cdk7 n/a
6 TRCN0000321769 CCAACCAAATCGTCGCCATTA pLKO_005 204 CDS 100% 10.800 15.120 N Cdk7 n/a
7 TRCN0000023086 CGGGCTCCTGAGTTATTGTTT pLKO.1 638 CDS 100% 5.625 7.875 N Cdk7 n/a
8 TRCN0000321833 CGGGCTCCTGAGTTATTGTTT pLKO_005 638 CDS 100% 5.625 7.875 N Cdk7 n/a
9 TRCN0000197042 GCCTACATGTTGATGACTCTT pLKO.1 449 CDS 100% 4.950 6.930 N CDK7 n/a
10 TRCN0000023087 GCTGACACCATCCCACATTAA pLKO.1 427 CDS 100% 13.200 9.240 N Cdk7 n/a
11 TRCN0000023084 CCAAACAACTTGTTGTTAGAT pLKO.1 521 CDS 100% 0.563 0.394 N Cdk7 n/a
12 TRCN0000000596 CATTTAAGAGTTTCCCTGGAA pLKO.1 846 CDS 100% 2.640 1.848 N CDK7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009874.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00280 pDONR223 100% 87.6% 95% None (many diffs) n/a
2 ccsbBroad304_00280 pLX_304 0% 87.6% 95% V5 (many diffs) n/a
3 TRCN0000470052 TGCGACTAGACTGATGGCACGATT pLX_317 46.6% 87.6% 95% V5 (many diffs) n/a
4 ccsbBroadEn_14577 pDONR223 0% 87.6% 95% None (many diffs) n/a
5 ccsbBroad304_14577 pLX_304 0% 87.6% 95% V5 (many diffs) n/a
6 TRCN0000481302 CGGTCTGAGCGTTCTGAGTTTCTA pLX_317 39.7% 87.6% 95% V5 (many diffs) n/a
7 ccsbBroadEn_15380 pDONR223 0% 87.5% 94.7% None (many diffs) n/a
8 ccsbBroad304_15380 pLX_304 0% 87.5% 94.7% V5 (many diffs) n/a
9 TRCN0000475074 AGAAGCTGTACGCAAACCTCGGCC pLX_317 53.1% 87.5% 94.7% V5 (many diffs) n/a
10 TRCN0000488377 TACTCTATAAACCTTGCAATCCGC pLX_317 26.5% 87.5% 95% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV