Construct: ORF TRCN0000481349
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016391.4_s317c1
- Derived from:
- ccsbBroadEn_14784
- DNA Barcode:
- AAAAGTTGGCCGAGCTATGAGGGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PRKAR1A (5573)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481349
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 5573 | PRKAR1A | protein kinase cAMP-depende... | NM_001276289.1 | 100% | 100% | |
2 | human | 5573 | PRKAR1A | protein kinase cAMP-depende... | NM_001278433.1 | 100% | 100% | |
3 | human | 5573 | PRKAR1A | protein kinase cAMP-depende... | NM_001369389.1 | 100% | 100% | |
4 | human | 5573 | PRKAR1A | protein kinase cAMP-depende... | NM_001369390.1 | 100% | 100% | |
5 | human | 5573 | PRKAR1A | protein kinase cAMP-depende... | NM_002734.4 | 100% | 100% | |
6 | human | 5573 | PRKAR1A | protein kinase cAMP-depende... | NM_212471.2 | 100% | 100% | |
7 | human | 5573 | PRKAR1A | protein kinase cAMP-depende... | NM_212472.2 | 100% | 100% | |
8 | human | 5573 | PRKAR1A | protein kinase cAMP-depende... | XM_011524984.3 | 100% | 100% | |
9 | human | 5573 | PRKAR1A | protein kinase cAMP-depende... | NM_001276290.1 | 87.3% | 85.4% | (many diffs) |
10 | mouse | 19084 | Prkar1a | protein kinase, cAMP depend... | NM_001313973.1 | 88.1% | 96.8% | (many diffs) |
11 | mouse | 19084 | Prkar1a | protein kinase, cAMP depend... | NM_001313974.1 | 88.1% | 96.8% | (many diffs) |
12 | mouse | 19084 | Prkar1a | protein kinase, cAMP depend... | NM_001313975.1 | 88.1% | 96.8% | (many diffs) |
13 | mouse | 19084 | Prkar1a | protein kinase, cAMP depend... | NM_001313976.1 | 88.1% | 96.8% | (many diffs) |
14 | mouse | 19084 | Prkar1a | protein kinase, cAMP depend... | NM_021880.3 | 88.1% | 96.8% | (many diffs) |
15 | mouse | 19084 | Prkar1a | protein kinase, cAMP depend... | XM_017314340.1 | 88.1% | 96.8% | (many diffs) |
16 | mouse | 19084 | Prkar1a | protein kinase, cAMP depend... | XM_006532509.1 | 65.8% | 72.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1209
- ORF length:
- 1143
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gtctggcagt accgccgcca gtgaggaggc acgcagcctt cgagaatgtg 121 agctctacgt ccagaagcat aacattcaag cgctgctcaa agattctatt gtgcagttgt 181 gcactgctcg acctgagaga cccatggcat tcctcaggga atactttgag aggttggaga 241 aggaggaggc aaaacagatt cagaatctgc agaaagcagg cactcgtaca gactcaaggg 301 aggatgagat ttctcctcct ccacccaacc cagtggttaa aggtaggagg cgacgaggtg 361 ctatcagcgc tgaggtctac acggaggaag atgcggcatc ctatgttaga aaggttatac 421 caaaagatta caagacaatg gccgctttag ccaaagccat tgaaaagaat gtgctgtttt 481 cacatcttga tgataatgag agaagtgata tttttgatgc catgttttcg gtctccttta 541 tcgcaggaga gactgtgatt cagcaaggtg atgaagggga taacttctat gtgattgatc 601 aaggagagac ggatgtctat gttaacaatg aatgggcaac cagtgttggg gaaggaggga 661 gctttggaga acttgctttg atttatggaa caccgagagc agccactgtc aaagcaaaga 721 caaatgtgaa attgtggggc atcgaccgag acagctatag aagaaTCCTC ATGGGAAGCA 781 CACTGAGAAA GCGGAAGATG TATGAGGAAT TCCTTAGTAA AGTCTCTATT TTAGAGTCTC 841 TGGACAAGTG GGAACGTCTT ACGGTAGCTG ATGCATTGGA ACCAGTGCAG TTTGAAGATG 901 GGCAGAAGAT TGTGGTGCAG GGAGAACCAG GGGATGAGTT CTTCATTATT TTAGAGGGGT 961 CAGCTGCTGT GCTACAACGT CGGTCAGAAA ATGAAGAGTT TGTTGAAGTG GGAAGATTGG 1021 GGCCTTCTGA TTATTTTGGT GAAATTGCAC TACTGATGAA TCGTCCTCGT GCTGCCACAG 1081 TTGTTGCTCG TGGCCCCTTG AAGTGCGTTA AGCTGGACCG ACCTAGATTT GAACGTGTTC 1141 TTGGCCCATG CTCAGACATC CTCAAACGAA ACATCCAGCA GTACAACAGT TTTGTGTCAC 1201 TGTCTGTCTG CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1261 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1321 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAAAAAGT TGGCCGAGCT ATGAGGGGAC 1381 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt