Transcript: Human NM_212471.2

Homo sapiens protein kinase cAMP-dependent type I regulatory subunit alpha (PRKAR1A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
PRKAR1A (5573)
Length:
4518
CDS:
370..1515

Additional Resources:

NCBI RefSeq record:
NM_212471.2
NBCI Gene record:
PRKAR1A (5573)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_212471.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039940 CGACCTAGATTTGAACGTGTT pLKO.1 1423 CDS 100% 4.050 5.670 N PRKAR1A n/a
2 TRCN0000199483 GCACTACTGATGAATCGTCCT pLKO.1 1351 CDS 100% 2.160 3.024 N PRKAR1A n/a
3 TRCN0000039941 GCATCCTATGTTAGAAAGGTT pLKO.1 700 CDS 100% 3.000 2.400 N PRKAR1A n/a
4 TRCN0000196340 GCCTTATGTGTTACATTATTC pLKO.1 2838 3UTR 100% 13.200 9.240 N PRKAR1A n/a
5 TRCN0000039942 GCGCTGCTCAAAGATTCTATT pLKO.1 454 CDS 100% 13.200 9.240 N PRKAR1A n/a
6 TRCN0000199411 CATTGGAACCAGTGCAGTTTG pLKO.1 1178 CDS 100% 10.800 7.560 N PRKAR1A n/a
7 TRCN0000221744 CCACTGTCAAAGCAAAGACAA pLKO.1 1007 CDS 100% 4.950 3.465 N Prkar1a n/a
8 TRCN0000039938 CCTCTGCTCATTAAACTGATT pLKO.1 2427 3UTR 100% 4.950 3.465 N PRKAR1A n/a
9 TRCN0000196434 GTCTATGTTAACAATGAATGG pLKO.1 919 CDS 100% 4.050 2.835 N PRKAR1A n/a
10 TRCN0000018369 GACTAGATACAGATGGAGCAA pLKO.1 2469 3UTR 100% 2.640 1.848 N PRKAR1A n/a
11 TRCN0000018368 GAAGATGTATGAGGAATTCCT pLKO.1 1098 CDS 100% 0.000 0.000 N PRKAR1A n/a
12 TRCN0000039939 GCGGAAGATGTATGAGGAATT pLKO.1 1095 CDS 100% 0.000 0.000 N PRKAR1A n/a
13 TRCN0000009885 TATTCCAATGATACCCAACAG pLKO.1 2854 3UTR 100% 4.050 2.430 N PRKAR1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_212471.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01280 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01280 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468368 GGGGTGGGGATGTTACTTTGTGGC pLX_317 34.9% 100% 100% V5 n/a
4 ccsbBroadEn_14784 pDONR223 0% 100% 100% None n/a
5 ccsbBroad304_14784 pLX_304 0% 100% 100% V5 n/a
6 TRCN0000481349 AAAAGTTGGCCGAGCTATGAGGGG pLX_317 39% 100% 100% V5 n/a
Download CSV