Transcript: Mouse NM_001313975.1

Mus musculus protein kinase, cAMP dependent regulatory, type I, alpha (Prkar1a), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-15
Taxon:
Mus musculus (mouse)
Gene:
Prkar1a (19084)
Length:
3407
CDS:
183..1328

Additional Resources:

NCBI RefSeq record:
NM_001313975.1
NBCI Gene record:
Prkar1a (19084)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001144984 TGAATGGGCAACCAGTGTTG pXPR_003 GGG 580 51% 7 0.4774 Prkar1a PRKAR1A 77721
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001313975.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285723 GCCTGTAATTAAGCTAGTTTA pLKO_005 1801 3UTR 100% 13.200 18.480 N Prkar1a n/a
2 TRCN0000221743 CCTCCTACGTTAGAAAGGTTA pLKO.1 514 CDS 100% 4.950 6.930 N Prkar1a n/a
3 TRCN0000221745 GCATTCCTTCGGGAATACTTT pLKO.1 324 CDS 100% 0.563 0.788 N Prkar1a n/a
4 TRCN0000274646 ATTGCTGGAGAGACGGTTATT pLKO_005 657 CDS 100% 13.200 10.560 N Prkar1a n/a
5 TRCN0000221742 CCCTTTGAAGTGCGTTAAGTT pLKO.1 1211 CDS 100% 5.625 4.500 N Prkar1a n/a
6 TRCN0000274643 CCCTTTGAAGTGCGTTAAGTT pLKO_005 1211 CDS 100% 5.625 4.500 N Prkar1a n/a
7 TRCN0000196340 GCCTTATGTGTTACATTATTC pLKO.1 2469 3UTR 100% 13.200 9.240 N PRKAR1A n/a
8 TRCN0000274594 TCCTTAGTAAAGTGTCTATTT pLKO_005 928 CDS 100% 13.200 9.240 N Prkar1a n/a
9 TRCN0000221746 CAAGGAGAAATGGATGTCTAT pLKO.1 717 CDS 100% 4.950 3.465 N Prkar1a n/a
10 TRCN0000274645 CAAGGAGAAATGGATGTCTAT pLKO_005 717 CDS 100% 4.950 3.465 N Prkar1a n/a
11 TRCN0000221744 CCACTGTCAAAGCAAAGACAA pLKO.1 820 CDS 100% 4.950 3.465 N Prkar1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001313975.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01280 pDONR223 100% 88.1% 96.8% None (many diffs) n/a
2 ccsbBroad304_01280 pLX_304 0% 88.1% 96.8% V5 (many diffs) n/a
3 TRCN0000468368 GGGGTGGGGATGTTACTTTGTGGC pLX_317 34.9% 88.1% 96.8% V5 (many diffs) n/a
4 ccsbBroadEn_14784 pDONR223 0% 88.1% 96.8% None (many diffs) n/a
5 ccsbBroad304_14784 pLX_304 0% 88.1% 96.8% V5 (many diffs) n/a
6 TRCN0000481349 AAAAGTTGGCCGAGCTATGAGGGG pLX_317 39% 88.1% 96.8% V5 (many diffs) n/a
Download CSV