Construct: ORF TRCN0000481396
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018275.1_s317c1
- Derived from:
- ccsbBroadEn_13141
- DNA Barcode:
- CGAACATGGCCAAACCCTCTAACT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SGSM1 (129049)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481396
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 129049 | SGSM1 | small G protein signaling m... | NM_001098497.3 | 55.5% | 55.5% | 1_1458del |
| 2 | human | 129049 | SGSM1 | small G protein signaling m... | NM_001039948.4 | 52.8% | 52.8% | 1_1623del |
| 3 | human | 129049 | SGSM1 | small G protein signaling m... | NM_001098498.3 | 49.9% | 49.9% | 1_1458del;1767_1768ins183 |
| 4 | human | 129049 | SGSM1 | small G protein signaling m... | NM_133454.3 | 47.5% | 47.5% | 1_1623del;1932_1933ins183 |
| 5 | mouse | 52850 | Sgsm1 | small G protein signaling m... | NM_001309528.1 | 64.9% | 68.8% | (many diffs) |
| 6 | mouse | 52850 | Sgsm1 | small G protein signaling m... | NM_172718.3 | 47.9% | 50.8% | (many diffs) |
| 7 | mouse | 52850 | Sgsm1 | small G protein signaling m... | XM_006535122.3 | 45.6% | 48.3% | (many diffs) |
| 8 | mouse | 52850 | Sgsm1 | small G protein signaling m... | NM_001254731.1 | 15.3% | 16.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1890
- ORF length:
- 1821
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gaagtaccag atcctctcca gagccttcta tggatggctg gcctactgca 121 gacacctgtc caccgtgaga acccacctat cagccctggt caatcacatg atcgtgtctc 181 cagacttgcc ctgcgatgct ggacagggac tgacagccag gatctgggag cagtaccttc 241 acgacagcac aagttacgag gagcaggagc tgctgcgcct catctactac gggggcatcc 301 agcctgagat ccgcaaggcc gtgtggccct tcctcctggg ccactaccag ttcgggatga 361 cggaaacaga aaggaaagag gtggacgagc agattcatgc ctgctatgca cagaccatgg 421 ctgagtggct gggctgcgag gcgatcgtgc ggcagaggga gcgggagtcc catgcggccg 481 ccctggccaa atgctcatcc ggggccagct tggacagcca cctgcaccgg atgttgcaca 541 gggactcaac catcagcaat gagtcctccc agagctgcag ttcgggccgc cagaacatcc 601 gcctgcacag cgactccagc agcagcacac aggtgtttga gtctgtggat gaggtggagc 661 aggtggaggc tgaaggcaga ttggaggaga aacagcccaa gatccccaat gggaacctag 721 tgaacggcac ttgttcccca gactcgggtc atccttcctc ccataacttc tcctcgggcc 781 tctcagagca ctcagagccc agtctgagca cagaagacag tgtcttggac gcccagcgga 841 acacccccac ggtgctgcga cctagggatg gcagcgtgga tgacaggcag agcagcgagg 901 ccaccacatc tcaggatgag gctccccggg aggagctggc cgtgcaggac agcctggaga 961 gtgacctcct ggccaacgag agcatggacg agttcatgtc catcacgggc agcctggaca 1021 tggccctgcc tgaaaaggac gatgttgtga tggagggctg gaggagcagc gagacagaga 1081 aacatggcca ggcggacagt gaggacaacc tctcggagga gcctgagatg gaaagtctct 1141 tccctgccct ggcttctctg gctgtgacta cttctgccaa cgaggtgtcc cctgtgtctt 1201 ccagcggcgt cacctactct ccagagctgc tggatctgta cacggtgaac ctgcaccgca 1261 tcgagaagga tgtgcagagg tgcgaccgca actactggta cttcacgccc gccaacttgg 1321 agaagctgcg taacatcatg tgcagctaca tctggcagca cattgagatc ggctatgtcc 1381 agggcatgtg tgatcttctg gctccactgc tggtcattcT GGATGATGAG GCCCTTGCCT 1441 TCAGCTGCTT CACGGAGCTC ATGAAGAGGA TGAACCAGAA CTTCCCCCAC GGAGGCGCCA 1501 TGGACACGCA CTTTGCAAAC ATGAGATCGT TGATCCAGAT CCTGGACTCA GAGCTGTTTG 1561 AGCTGATGCA TCAGAACGGG GACTATACTC ACTTCTACTT CTGCTACCGC TGGTTCCTGC 1621 TGGATTTCAA GCGAGAACTC GTCTATGATG ACGTCTTCTT GGTCTGGGAG ACCATCTGGG 1681 CAGCCAAACA CGTCTCCTCT GCGCACTACG TCCTGTTCAT TGCGCTGGCT CTGGTGGAAG 1741 TCTACCGTGA CATCATTTTG GAGAACAACA TGGATTTCAC AGACATCATC AAATTCTTTA 1801 ATGAAATGGC TGAGCGACAC AACACCAAGC AAGTCCTGAA GCTGGCGCGG GACCTCGTGT 1861 ACAAGGTGCA GACTCTGATT GAGAACAAGT TGCCAACTTT CTTGTACAAA GTGGTTGATA 1921 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1981 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGACGAAC 2041 ATGGCCAAAC CCTCTAACTA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 2101 tgaaagatt