Transcript: Human NM_133454.3

Homo sapiens small G protein signaling modulator 1 (SGSM1), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
SGSM1 (129049)
Length:
5961
CDS:
106..3369

Additional Resources:

NCBI RefSeq record:
NM_133454.3
NBCI Gene record:
SGSM1 (129049)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_133454.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245918 TCAAGCGAGAACTCGTCTATG pLKO_005 3104 CDS 100% 10.800 15.120 N SGSM1 n/a
2 TRCN0000245921 ATAAGATTGCAGCCCTCTTTA pLKO_005 308 CDS 100% 13.200 9.240 N SGSM1 n/a
3 TRCN0000245919 ATGATGAGGCCACGGATTATG pLKO_005 1337 CDS 100% 13.200 9.240 N SGSM1 n/a
4 TRCN0000245920 TGACCCTCCACCTCGACATTA pLKO_005 3850 3UTR 100% 13.200 9.240 N SGSM1 n/a
5 TRCN0000245917 CTTCACGACAGCACAAGTTAC pLKO_005 1897 CDS 100% 10.800 7.560 N SGSM1 n/a
6 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 4190 3UTR 100% 4.950 2.475 Y CFLAR n/a
7 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 4190 3UTR 100% 4.950 2.475 Y C19orf31 n/a
8 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 4188 3UTR 100% 4.950 2.475 Y ERN2 n/a
9 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 4188 3UTR 100% 4.950 2.475 Y P3H4 n/a
10 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 4188 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133454.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13141 pDONR223 100% 47.5% 47.5% None 1_1623del;1932_1933ins183 n/a
2 ccsbBroad304_13141 pLX_304 0% 47.5% 47.5% V5 1_1623del;1932_1933ins183 n/a
3 TRCN0000481396 CGAACATGGCCAAACCCTCTAACT pLX_317 26% 47.5% 47.5% V5 1_1623del;1932_1933ins183 n/a
Download CSV