Transcript: Mouse XM_006535122.3

PREDICTED: Mus musculus small G protein signaling modulator 1 (Sgsm1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sgsm1 (52850)
Length:
5325
CDS:
94..3540

Additional Resources:

NCBI RefSeq record:
XM_006535122.3
NBCI Gene record:
Sgsm1 (52850)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535122.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093375 GCAGATTCTAATTGAGAACAA pLKO.1 3516 CDS 100% 4.950 3.960 N Sgsm1 n/a
2 TRCN0000093374 GCCTCCTATTTATTCCATTTA pLKO.1 5134 3UTR 100% 13.200 9.240 N Sgsm1 n/a
3 TRCN0000093376 CCACTGAAACTGCTGTGTGAT pLKO.1 1693 CDS 100% 4.950 3.465 N Sgsm1 n/a
4 TRCN0000093378 AGATCATGGAAGAAGCCGTTA pLKO.1 164 CDS 100% 4.050 2.835 N Sgsm1 n/a
5 TRCN0000093377 CAGCTATATCTGGCAGCACAT pLKO.1 2991 CDS 100% 4.050 2.835 N Sgsm1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535122.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13141 pDONR223 100% 45.6% 48.3% None (many diffs) n/a
2 ccsbBroad304_13141 pLX_304 0% 45.6% 48.3% V5 (many diffs) n/a
3 TRCN0000481396 CGAACATGGCCAAACCCTCTAACT pLX_317 26% 45.6% 48.3% V5 (many diffs) n/a
Download CSV