Construct: ORF TRCN0000481493
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005745.1_s317c1
- Derived from:
- ccsbBroadEn_06352
- DNA Barcode:
- AGATTCATTAACACTGCTTTCTAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HAS3 (3038)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481493
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3038 | HAS3 | hyaluronan synthase 3 | NM_138612.3 | 99.8% | 100% | 279A>G |
| 2 | human | 3038 | HAS3 | hyaluronan synthase 3 | NM_001199280.2 | 48.1% | 45.6% | (many diffs) |
| 3 | human | 3038 | HAS3 | hyaluronan synthase 3 | NM_005329.2 | 48.1% | 45.6% | (many diffs) |
| 4 | human | 3038 | HAS3 | hyaluronan synthase 3 | XM_005255921.2 | 48.1% | 45.6% | (many diffs) |
| 5 | human | 3038 | HAS3 | hyaluronan synthase 3 | XM_011523061.2 | 48.1% | 45.6% | (many diffs) |
| 6 | mouse | 15118 | Has3 | hyaluronan synthase 3 | NM_001331048.1 | 43% | 42.8% | (many diffs) |
| 7 | mouse | 15118 | Has3 | hyaluronan synthase 3 | NM_008217.4 | 43% | 42.8% | (many diffs) |
| 8 | mouse | 15118 | Has3 | hyaluronan synthase 3 | XM_006530700.3 | 43% | 42.8% | (many diffs) |
| 9 | mouse | 15118 | Has3 | hyaluronan synthase 3 | XM_006530701.2 | 43% | 42.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 909
- ORF length:
- 843
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc ggtgcagctg acgacagccc tgcgtgtggt gggcaccagc ctgtttgccc 121 tggcagtgct gggtggcatc ctggcagcct atgtgacggg ctaccagttc atccacacgg 181 aaaagcacta cctgtccttc ggcctgtacg gcgccatcct gggcctgcac ctgctcattc 241 agagcctttt tgccttcctg gagcaccggc gcatgcgacg tgccggccag gccctgaagc 301 tgccctcccc gcggcggggc tcggtggcac tgtgcattgc cgcgtaccag gaggaccctg 361 actacttgcg caagtgcctg cgctcggccc agcgcatctc cttccctgac ctcaaggtgg 421 tcatggtggt ggatggcaac cgccaggagg acgcctacat gctggacatc ttccacgagg 481 tgctgggcgg caccgagcag gccggcttct ttgtgtggcg cagcaacttc catgaggCAG 541 GCGAGGGTGA GACGGAGGCC AGCCTGCAGG AGGGCATGGA CCGTGTGCGG GATGTGGTGC 601 GGGCCAGCAC CTTCTCGTGC ATCATGCAGA AGTGGGGAGG CAAGCGCGAG GTCATGTACA 661 CGGCCTTCAA GGCCCTCGGC GATTCGGTGG ACTACATCCA GGTGTGCGAC TCTGACACTG 721 TGCTGGATCC AGCCTGCACC ATCGAGATGC TTCGAGTCCT GGAGGAGGAT CCCCAAGTAG 781 GGGGAGTCGG GGGAGATGTC CAGCCCCCAG GGAAAGGTAT GGCAGTAGAG GATGACCAGG 841 TCCAAGCTGC CCAGGTCAGA GCTACGGAAG CATGGTCCGT TCACCAACGC CACGTTTCTA 901 GAGAGCAGTG CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 961 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1021 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAAGATTC ATTAACACTG CTTTCTATAC 1081 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt