Transcript: Mouse NM_001331048.1

Mus musculus hyaluronan synthase 3 (Has3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Has3 (15118)
Length:
5855
CDS:
117..1781

Additional Resources:

NCBI RefSeq record:
NM_001331048.1
NBCI Gene record:
Has3 (15118)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001331048.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076265 CGTGAACTTCATTGGCCTAAT pLKO.1 1544 CDS 100% 10.800 15.120 N Has3 n/a
2 TRCN0000418844 GATTAGCCATCAATGCGTTAA pLKO_005 2237 3UTR 100% 10.800 15.120 N Has3 n/a
3 TRCN0000076263 CCGATCTGAAACGCAAAGAAT pLKO.1 1891 3UTR 100% 5.625 7.875 N Has3 n/a
4 TRCN0000076267 GCAAGTCTTACTTTCGGGAAT pLKO.1 1192 CDS 100% 4.050 5.670 N Has3 n/a
5 TRCN0000076264 GCAATGTATTAGTGGGCCTTT pLKO.1 959 CDS 100% 4.050 5.670 N Has3 n/a
6 TRCN0000417066 TTGGCTACCGGACTAAGTATA pLKO_005 1099 CDS 100% 13.200 9.240 N Has3 n/a
7 TRCN0000076266 CCAGGAAGATACCTACATGTT pLKO.1 497 CDS 100% 4.950 3.465 N Has3 n/a
8 TRCN0000415836 TGCTGTATCTGGCCATTATTG pLKO_005 1705 CDS 100% 13.200 7.920 N Has3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001331048.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06352 pDONR223 100% 43% 42.8% None (many diffs) n/a
2 ccsbBroad304_06352 pLX_304 0% 43% 42.8% V5 (many diffs) n/a
3 TRCN0000481493 AGATTCATTAACACTGCTTTCTAT pLX_317 44.2% 43% 42.8% V5 (many diffs) n/a
Download CSV