Construct: ORF TRCN0000481559
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003185.2_s317c1
- Derived from:
- ccsbBroadEn_04552
- DNA Barcode:
- GCGCAATCGCTAACATTTTTTGGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ATPAF2 (91647)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481559
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 91647 | ATPAF2 | ATP synthase mitochondrial ... | NM_145691.4 | 100% | 100% | |
| 2 | human | 91647 | ATPAF2 | ATP synthase mitochondrial ... | XM_011524065.2 | 87.8% | 82.5% | (many diffs) |
| 3 | human | 91647 | ATPAF2 | ATP synthase mitochondrial ... | XM_005256848.4 | 84.3% | 82.5% | (many diffs) |
| 4 | human | 91647 | ATPAF2 | ATP synthase mitochondrial ... | XM_017025302.1 | 65.3% | 63.3% | 0_1ins154;23_24ins146 |
| 5 | human | 91647 | ATPAF2 | ATP synthase mitochondrial ... | XM_017025303.1 | 53.6% | 46.9% | (many diffs) |
| 6 | human | 91647 | ATPAF2 | ATP synthase mitochondrial ... | XR_001752677.2 | 48.3% | 1_155del;770_1011del;1265_1795del | |
| 7 | mouse | 246782 | Atpaf2 | ATP synthase mitochondrial ... | NM_145427.2 | 83.5% | 84.5% | (many diffs) |
| 8 | mouse | 246782 | Atpaf2 | ATP synthase mitochondrial ... | XM_011249024.2 | 62.8% | 61.1% | (many diffs) |
| 9 | mouse | 246782 | Atpaf2 | ATP synthase mitochondrial ... | XM_006533343.3 | 61.2% | 57.6% | (many diffs) |
| 10 | mouse | 246782 | Atpaf2 | ATP synthase mitochondrial ... | XM_011249025.2 | 57.4% | 58.1% | (many diffs) |
| 11 | mouse | 246782 | Atpaf2 | ATP synthase mitochondrial ... | XM_011249026.2 | 57.4% | 58.1% | (many diffs) |
| 12 | mouse | 246782 | Atpaf2 | ATP synthase mitochondrial ... | XM_006533344.3 | 55.8% | 58.4% | (many diffs) |
| 13 | mouse | 246782 | Atpaf2 | ATP synthase mitochondrial ... | XM_006533345.3 | 55.8% | 58.4% | (many diffs) |
| 14 | mouse | 246782 | Atpaf2 | ATP synthase mitochondrial ... | XM_006533346.3 | 55.8% | 58.4% | (many diffs) |
| 15 | mouse | 246782 | Atpaf2 | ATP synthase mitochondrial ... | XM_017314556.1 | 55.8% | 58.4% | (many diffs) |
| 16 | mouse | 246782 | Atpaf2 | ATP synthase mitochondrial ... | XR_001780007.1 | 42.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 933
- ORF length:
- 867
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtg gaggagctgc ctccggctgc gggacggggg acgccgtctc ctgaatcggc 121 cggcgggtgg ccccagcgct tctatgagtc cggggccaac catcccgtct ccagcccggg 181 cttacgcccc gccgacagaa aggaagaggt tttatcagaa tgtcagcatc acacagggtg 241 aaggtggctt tgagataaac ctggaccaca ggaagctgaa aactccccaa gccaagctct 301 ttaccgtccc cagcgaggcc ctggccattg cagtggctac tgagtgggat tcccagcagg 361 ataccatcaa gtactacacc atgcacctga ccacattgtg caacacatca ttggacaacc 421 caacccagag aaacaaggat cagctgatcc gggcagccgt gaagtttctg gacaccgaca 481 ccatctgcta cagggtggag gagcccgaga cattagtgga aCTTCAAAGG AATGAGTGGG 541 ATCCAATCAT CGAATGGGCT GAGAAAAGAT ACGGCGTGGA GATCAGCTCC TCCACCAGCA 601 TAATGGGACC CAGCATCCCT GCCAAAACTC GGGAGGTGCT CGTCAGCCAC CTGGCATCTT 661 ACAACACATG GGCTTTACAA GGGATTGAGT TTGTAGCTGC CCAGCTCAAG TCCATGGTGC 721 TAACCTTGGG CCTGATTGAC CTGCGCCTGA CAGTGGAGCA GGCCGTGCTG CTGTCACGCC 781 TGGAGGAGGA GTACCAGATC CAGAAGTGGG GCAACATTGA GTGGGCCCAT GACTATGAGC 841 TGCAGGAGCT GCGGGCCCGC ACCGCCGCCG GCACCCTCTT CATCCATCTC TGCTCCGAGA 901 GCACCACAGT CAAGCACAAG CTCCTGAAGG AGTGCCCAAC TTTCTTGTAC AAAGTGGTTG 961 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1021 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGAGC 1081 GCAATCGCTA ACATTTTTTG GAACGCGTTA AGTCgacaat caacctctgg attacaaaat 1141 ttgtgaaaga tt