Transcript: Mouse XM_006533345.3

PREDICTED: Mus musculus ATP synthase mitochondrial F1 complex assembly factor 2 (Atpaf2), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atpaf2 (246782)
Length:
1359
CDS:
442..996

Additional Resources:

NCBI RefSeq record:
XM_006533345.3
NBCI Gene record:
Atpaf2 (246782)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533345.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076181 TGACCACATTGTGCAACACAT pLKO.1 449 CDS 100% 4.950 6.930 N Atpaf2 n/a
2 TRCN0000076179 CCAGAGACATTAGTGGAACTT pLKO.1 565 CDS 100% 4.950 3.960 N Atpaf2 n/a
3 TRCN0000076182 GTGCAACACATCCTTGGACAA pLKO.1 459 CDS 100% 4.050 3.240 N Atpaf2 n/a
4 TRCN0000076180 CCACTTGTCCTCTTACAACAT pLKO.1 708 CDS 100% 4.950 2.970 N Atpaf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533345.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04552 pDONR223 100% 55.8% 58.4% None (many diffs) n/a
2 ccsbBroad304_04552 pLX_304 0% 55.8% 58.4% V5 (many diffs) n/a
3 TRCN0000481559 GCGCAATCGCTAACATTTTTTGGA pLX_317 47.5% 55.8% 58.4% V5 (many diffs) n/a
4 ccsbBroadEn_09320 pDONR223 100% 55.7% 58.4% None (many diffs) n/a
5 ccsbBroad304_09320 pLX_304 0% 55.7% 58.4% V5 (many diffs) n/a
6 TRCN0000492216 ACCTTTCTTTAGTTATAATGTTGT pLX_317 36.9% 55.7% 58.4% V5 (many diffs) n/a
Download CSV