Transcript: Human XM_005256848.4

PREDICTED: Homo sapiens ATP synthase mitochondrial F1 complex assembly factor 2 (ATPAF2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATPAF2 (91647)
Length:
1156
CDS:
156..926

Additional Resources:

NCBI RefSeq record:
XM_005256848.4
NBCI Gene record:
ATPAF2 (91647)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005256848.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045868 CCCGAGACATTAGTGGAACTT pLKO.1 594 CDS 100% 4.950 6.930 N ATPAF2 n/a
2 TRCN0000290110 CCCGAGACATTAGTGGAACTT pLKO_005 594 CDS 100% 4.950 6.930 N ATPAF2 n/a
3 TRCN0000076181 TGACCACATTGTGCAACACAT pLKO.1 478 CDS 100% 4.950 6.930 N Atpaf2 n/a
4 TRCN0000045871 GTGCAACACATCATTGGACAA pLKO.1 488 CDS 100% 4.050 3.240 N ATPAF2 n/a
5 TRCN0000290109 GTGCAACACATCATTGGACAA pLKO_005 488 CDS 100% 4.050 3.240 N ATPAF2 n/a
6 TRCN0000045869 CCAGCAGGATACCATCAAGTA pLKO.1 443 CDS 100% 4.950 3.465 N ATPAF2 n/a
7 TRCN0000290111 CCAGCAGGATACCATCAAGTA pLKO_005 443 CDS 100% 4.950 3.465 N ATPAF2 n/a
8 TRCN0000045872 GCCGACAGAAAGGAAGAGGTT pLKO.1 281 CDS 100% 2.640 1.848 N ATPAF2 n/a
9 TRCN0000290041 GCCGACAGAAAGGAAGAGGTT pLKO_005 281 CDS 100% 2.640 1.848 N ATPAF2 n/a
10 TRCN0000045870 GCATCTTACAACACATGGGCT pLKO.1 744 CDS 100% 0.660 0.462 N ATPAF2 n/a
11 TRCN0000290038 GCATCTTACAACACATGGGCT pLKO_005 744 CDS 100% 0.660 0.462 N ATPAF2 n/a
12 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 945 3UTR 100% 4.950 2.475 Y CFLAR n/a
13 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 945 3UTR 100% 4.950 2.475 Y C19orf31 n/a
14 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 943 3UTR 100% 4.950 2.475 Y ERN2 n/a
15 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 943 3UTR 100% 4.950 2.475 Y P3H4 n/a
16 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 943 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005256848.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04552 pDONR223 100% 84.3% 82.5% None (many diffs) n/a
2 ccsbBroad304_04552 pLX_304 0% 84.3% 82.5% V5 (many diffs) n/a
3 TRCN0000481559 GCGCAATCGCTAACATTTTTTGGA pLX_317 47.5% 84.3% 82.5% V5 (many diffs) n/a
4 ccsbBroadEn_09320 pDONR223 100% 84.2% 82.5% None (many diffs) n/a
5 ccsbBroad304_09320 pLX_304 0% 84.2% 82.5% V5 (many diffs) n/a
6 TRCN0000492216 ACCTTTCTTTAGTTATAATGTTGT pLX_317 36.9% 84.2% 82.5% V5 (many diffs) n/a
Download CSV