Construct: ORF TRCN0000481581
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018128.1_s317c1
- Derived from:
- ccsbBroadEn_06317
- DNA Barcode:
- CTTCCTAATCAATGCGATTCTGCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GPR26 (2849)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481581
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2849 | GPR26 | G protein-coupled receptor 26 | NM_153442.4 | 99.8% | 100% | 489A>G;642G>C |
| 2 | mouse | 233919 | Gpr26 | G protein-coupled receptor 26 | NM_173410.3 | 91.4% | 95.2% | (many diffs) |
| 3 | mouse | 233919 | Gpr26 | G protein-coupled receptor 26 | XM_006507766.3 | 71.9% | 75% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1080
- ORF length:
- 1011
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gaactcgtgg gacgcgggcc tggcggggct actggtgggc acgatgggcg 121 tctcgctgct gtccaacgcg ctggtgctgc tctgcctgct gcacagcgcg gacatccgcc 181 gccaggcgcc ggcgctcttc accctgaacc tcacgtgcgg gaacctgctg tgcaccgtgg 241 tcaacatgcc gctcacgctg gccggcgtcg tggcgcagcg gcagccggcg ggcgaccgcc 301 tgtgccgcct ggctgccttc ctcgacacct tcctggctgc caactccatg ctcagcatgg 361 ccgcgctcag catcgaccgc tgggtggccg tggtcttccc gctgagctac cgggccaaga 421 tgcgcctccg cgacgcggcg ctcatggtgg cctacacgtg gctgcacgcg ctcaccttcc 481 cagccgccgc gctcgccctg tcctggctcg gcttccacca gctgtacgcc tcgtgcacgc 541 tgtgcagccg gcggccggac gagcgcctgc gcttcgccgt cttcactggc gccttccacg 601 ctctcagctt cctgctctcc ttcgtcgtgc TCTGCTGCAC GTACCTCAAG GTGCTCAAGG 661 TGGCCCGCTT CCATTGCAAG CGCATCGACG TGATCACCAT GCAGACGCTC GTGCTGCTGG 721 TGGACCTGCA CCCCAGTGTG CGGGAACGCT GTCTGGAGGA GCAGAAGCGG AGGCGACAGC 781 GAGCCACCAA GAAGATCAGC ACCTTCATAG GGACCTTCCT TGTGTGCTTC GCGCCCTATG 841 TGATCACCAG GCTAGTGGAG CTCTTCTCCA CGGTGCCCAT CGGCTCCCAC TGGGGGGTGC 901 TGTCCAAGTG CTTGGCGTAC AGCAAGGCCG CATCCGACCC CTTTGTGTAC TCCTTACTGC 961 GACACCAGTA CCGCAAAAGC TGCAAGGAGA TTCTGAACAG GCTCCTGCAC AGACGCTCCA 1021 TCCACTCCTC TGGCCTCACA GGCGACTCTC ACAGCCAGAA CATTCTGCCG GTGTCTGAGT 1081 TGCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1141 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1201 TTTATATATC TTGTGGAAAG GACGACTTCC TAATCAATGC GATTCTGCAA CGCGTTAAGT 1261 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt