Transcript: Human NM_153442.4

Homo sapiens G protein-coupled receptor 26 (GPR26), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
GPR26 (2849)
Length:
10306
CDS:
54..1067

Additional Resources:

NCBI RefSeq record:
NM_153442.4
NBCI Gene record:
GPR26 (2849)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153442.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357150 TTGCAAGCGCATCGACGTGAT pLKO_005 659 CDS 100% 4.050 5.670 N GPR26 n/a
2 TRCN0000367801 GATATTGGACACTCCTTATTT pLKO_005 1241 3UTR 100% 15.000 10.500 N GPR26 n/a
3 TRCN0000008864 CCTGAGTTTAATGAGGATATT pLKO.1 4505 3UTR 100% 13.200 9.240 N GPR26 n/a
4 TRCN0000357149 ACTCTCACAGCCAGAACATTC pLKO_005 1030 CDS 100% 10.800 7.560 N GPR26 n/a
5 TRCN0000357151 AGAAGATCAGCACCTTCATAG pLKO_005 775 CDS 100% 10.800 7.560 N GPR26 n/a
6 TRCN0000008865 CGACTCTCACAGCCAGAACAT pLKO.1 1028 CDS 100% 4.950 3.465 N GPR26 n/a
7 TRCN0000008867 CCCTATGTGATCACCAGGCTA pLKO.1 819 CDS 100% 2.640 1.848 N GPR26 n/a
8 TRCN0000008866 GCTCTGCTGCACGTACCTCAA pLKO.1 614 CDS 100% 1.350 0.945 N GPR26 n/a
9 TRCN0000008868 CCGCTTCCATTGCAAGCGCAT pLKO.1 650 CDS 100% 0.072 0.050 N GPR26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153442.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06317 pDONR223 100% 99.8% 100% None 489A>G;642G>C n/a
2 ccsbBroad304_06317 pLX_304 0% 99.8% 100% V5 489A>G;642G>C n/a
3 TRCN0000481581 CTTCCTAATCAATGCGATTCTGCA pLX_317 44.4% 99.8% 100% V5 489A>G;642G>C n/a
4 TRCN0000489387 ACTCAATCACTTTAGCCTGAGGAA pLX_317 35.2% 99.8% 100% V5 (not translated due to prior stop codon) 489A>G;642G>C n/a
5 TRCN0000489409 ATGGTCTATATCTTACATACTTGC pLX_317 34.5% 99.7% 99.7% V5 489A>G;642G>C;1011_1012insG n/a
Download CSV