Construct: ORF TRCN0000481623
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002307.1_s317c1
- Derived from:
- ccsbBroadEn_05905
- DNA Barcode:
- TGAAAAATGATCCACTTTGTCCTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- BST1 (683)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481623
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 683 | BST1 | bone marrow stromal cell an... | NM_004334.3 | 99.8% | 100% | 258G>C |
2 | human | 683 | BST1 | bone marrow stromal cell an... | XM_011513879.2 | 91.6% | 90.2% | (many diffs) |
3 | human | 683 | BST1 | bone marrow stromal cell an... | XM_005248185.2 | 90.7% | 89.3% | (many diffs) |
4 | human | 683 | BST1 | bone marrow stromal cell an... | XM_017008566.2 | 90.7% | 88.2% | (many diffs) |
5 | human | 683 | BST1 | bone marrow stromal cell an... | XM_017008565.2 | 90.3% | 90.8% | (many diffs) |
6 | human | 683 | BST1 | bone marrow stromal cell an... | XM_011513878.3 | 90.1% | 89.6% | (many diffs) |
7 | human | 683 | BST1 | bone marrow stromal cell an... | XM_005248186.2 | 89.5% | 89.3% | (many diffs) |
8 | human | 683 | BST1 | bone marrow stromal cell an... | XM_011513881.2 | 81.2% | 80.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1020
- ORF length:
- 954
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggcccagggg tgcgcggcat cgcggctgct ccagctgctg ctgcagcttc 121 tgcttctact gttgctgctg gcggcgggcg gggcgcgcgc gcggtggcgc ggggagggca 181 ccagcgcaca cttgcgggac atcttcctgg gccgctgcgc cgagtaccgc gcactgctga 241 gtcccgagca gcggaacaag aactgcacag ccatctggga agcctttaaa gtggcgctgg 301 acaaggatcc ctgctccgtg ctcccctcag actatgacct ttttattaac ttgtccaggc 361 actctattcc cagagataag tccctgttct gggaaaatag ccacctcctt gttaacagct 421 ttgcagacaa cacccgtcgt tttatgcccc tgagcgatgt tctgtatggc agggttgcag 481 atttcttgag ctggtgtcga cagaaaaatg actctggact cgattaccaa tcctgcccta 541 catcagaaga ctgtgaaaat aaTCCTGTGG ATTCCTTTTG GAAAAGGGCA TCCATCCAGT 601 ATTCCAAGGA TAGTTCTGGG GTGATCCACG TCATGCTGAA TGGTTCAGAG CCAACAGGAG 661 CCTATCCCAT CAAAGGTTTT TTTGCAGATT ATGAAATTCC AAACCTCCAG AAGGAAAAAA 721 TTACACGAAT CGAGATCTGG GTTATGCATG AAATTGGGGG ACCCAATGTG GAATCCTGCG 781 GGGAAGGCAG CATGAAAGTC CTGGAAAAGA GGCTGAAGGA CATGGGGTTC CAGTACAGCT 841 GTATTAATGA TTACCGACCA GTGAAGCTCT TACAGTGCGT GGACCACAGC ACCCATCCTG 901 ACTGTGCCTT AAAGTCGGCA GCAGCCGCTA CTCAAAGAAA AGCCCCAAGT CTTTATACAG 961 AACAAAGGGC GGGTCTTATC ATTCCCCTCT TTCTGGTGCT GGCTTCCAGG ACTCAACTGT 1021 ACCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1081 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1141 TTTATATATC TTGTGGAAAG GACGATGAAA AATGATCCAC TTTGTCCTCA CGCGTTAAGT 1201 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt