Transcript: Human XM_011513878.3

PREDICTED: Homo sapiens bone marrow stromal cell antigen 1 (BST1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BST1 (683)
Length:
1070
CDS:
148..1050

Additional Resources:

NCBI RefSeq record:
XM_011513878.3
NBCI Gene record:
BST1 (683)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513878.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425495 ACCGACCAGTGAAGCTCTTAC pLKO_005 935 CDS 100% 10.800 15.120 N BST1 n/a
2 TRCN0000425864 ACGAATCGAGATCTGGGTTAT pLKO_005 807 CDS 100% 10.800 15.120 N BST1 n/a
3 TRCN0000051661 CCATCCTGACTGTGCCTTAAA pLKO.1 975 CDS 100% 13.200 9.240 N BST1 n/a
4 TRCN0000051662 CCATCCAGTATTCCAAGGATA pLKO.1 674 CDS 100% 4.950 3.465 N BST1 n/a
5 TRCN0000051660 CCTACATCAGAAGACTGTGAA pLKO.1 619 CDS 100% 4.950 3.465 N BST1 n/a
6 TRCN0000051659 GCAGCATGAAAGTCCTGGAAA pLKO.1 869 CDS 100% 4.950 3.465 N BST1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513878.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05905 pDONR223 100% 90.1% 89.6% None (many diffs) n/a
2 ccsbBroad304_05905 pLX_304 0% 90.1% 89.6% V5 (many diffs) n/a
3 TRCN0000481623 TGAAAAATGATCCACTTTGTCCTC pLX_317 48% 90.1% 89.6% V5 (many diffs) n/a
Download CSV